SMC1A

SMC1A antibody
23082-100ul	SAB	100ul	EUR 390

SMC1A antibody
70R-13301	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal SMC1A antibody

SMC1A antibody
10R-2958	Fitzgerald	3 ml	EUR 282
Description: Rat monoclonal SMC1A antibody

SMC1A Antibody
1-CSB-PA060231	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SMC1A. Recognizes SMC1A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

SMC1A Antibody
1-CSB-PA614804ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SMC1A. Recognizes SMC1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SMC1A antibody
70R-8278	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SMC1A antibody

SMC1A siRNA
20-abx905149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SMC1A siRNA
20-abx934332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SMC1A siRNA
20-abx934333	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SMC1A Polyclonal Antibody
30411-100ul	SAB	100ul	EUR 252

SMC1A Polyclonal Antibody
30411-50ul	SAB	50ul	EUR 187

SMC1A Polyclonal Antibody
30791-100ul	SAB	100ul	EUR 252

SMC1A Polyclonal Antibody
30791-50ul	SAB	50ul	EUR 187

SMC1A Blocking Peptide
33R-9611	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SMC1A antibody, catalog no. 70R-8278

SMC1A cloning plasmid
CSB-CL614804HU-10ug	Cusabio	10ug	EUR 1305
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3702 Sequence: atggggttcctgaaactgattgagattgagaactttaagtcgtacaagggtcgacagattatcggaccatttcagaggttcaccgccatcattggacccaatggctctggtaagtcaaatctcatggatgccatcagctttgtgctaggtgaaaaaaccagcaacctgcgggtaa Show more
Description: A cloning plasmid for the SMC1A gene.

SMC1A Rabbit pAb
A7008-100ul	Abclonal	100 ul	EUR 308

SMC1A Rabbit pAb
A7008-200ul	Abclonal	200 ul	EUR 459

SMC1A Rabbit pAb
A7008-20ul	Abclonal	20 ul	EUR 183

SMC1A Rabbit pAb
A7008-50ul	Abclonal	50 ul	EUR 223

SMC1A Rabbit pAb
A2240-100ul	Abclonal	100 ul	EUR 308

SMC1A Rabbit pAb
A2240-200ul	Abclonal	200 ul	EUR 459

SMC1A Rabbit pAb
A2240-20ul	Abclonal	20 ul	EUR 183

SMC1A Rabbit pAb
A2240-50ul	Abclonal	50 ul	EUR 223

SMC1A (pS957) Antibody
20-abx000162	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

SMC1A (pS957) Antibody
20-abx000256	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

anti- SMC1A antibody
FNab08016	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:20 - 1:100 IP : 1:50 - 1:100 Immunogen: structural maintenance of chromosomes 1A Uniprot ID: Q14683 Gene ID: 8243 Research Area: Cell Division and Proliferation, Metabolism, Developm Show more
Description: Antibody raised against SMC1A

Anti-SMC1A antibody
PAab08016	Lifescience Market	100 ug	EUR 386

Anti-SMC1A antibody
STJ116171	St John's Laboratory	100 µl	EUR 277
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SMC1A antibody
STJ29088	St John's Laboratory	100 µl	EUR 277
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SMC1A antibody
STJ99053	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to SMC1A.

Anti-SMC1A antibody
STJ99054	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to SMC1A.

Phospho-SMC1A (S957) Antibody
1-CSB-PA060229	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SMC1A (S957). Recognizes Phospho-SMC1A (S957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-SMC1A (S966) Antibody
1-CSB-PA060230	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SMC1A (S966). Recognizes Phospho-SMC1A (S966) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

SMC1A (Ab-957) Antibody
CSB-PA775738-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SMC1A (Ab-957). Recognizes SMC1A (Ab-957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

SMC1A (Ab-957) Antibody
CSB-PA775738-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SMC1A (Ab-957). Recognizes SMC1A (Ab-957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

Phospho-SMC1A (Ser957) Antibody
CSB-PA581416-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SMC1A (Ser957). Recognizes Phospho-SMC1A (Ser957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-SMC1A (Ser957) Antibody
CSB-PA581416-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SMC1A (Ser957). Recognizes Phospho-SMC1A (Ser957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Mouse Smc1a ELISA KIT
ELI-19141m	Lifescience Market	96 Tests	EUR 865

Human SMC1A ELISA KIT
ELI-29846h	Lifescience Market	96 Tests	EUR 824

SMC1A ELISA KIT|Human
EF003058	Lifescience Market	96 Tests	EUR 689

Mouse SMC1A shRNA Plasmid
20-abx973623	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SMC1A shRNA Plasmid
20-abx986121	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SMC1A Polyclonal Conjugated Antibody
C30411	SAB	100ul	EUR 397

SMC1A Polyclonal Conjugated Antibody
C30791	SAB	100ul	EUR 397

Human SMC1A shRNA Plasmid
20-abx955413	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine SMC1A ELISA KIT
ELI-39429b	Lifescience Market	96 Tests	EUR 928

pCR-XL-TOPO-SMC1A
PVT14390	Lifescience Market	2 ug	EUR 703

SMC1A(N-term) Monoclonal Antibody
27022-100ul	SAB	100ul	EUR 252

SMC1A(N-term) Monoclonal Antibody
27022-50ul	SAB	50ul	EUR 187

SMC1A(C-term) Monoclonal Antibody
27023-100ul	SAB	100ul	EUR 252

SMC1A(C-term) Monoclonal Antibody
27023-50ul	SAB	50ul	EUR 187

Polyclonal SMC1A Antibody (N-term)
APR03833G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SMC1A (N-term). This antibody is tested and proven to work in the following applications:

Phospho-SMC1A-S957 Rabbit pAb
AP0090-100ul	Abclonal	100 ul	EUR 384

Phospho-SMC1A-S957 Rabbit pAb
AP0090-200ul	Abclonal	200 ul	EUR 554

Phospho-SMC1A-S957 Rabbit pAb
AP0090-20ul	Abclonal	20 ul	EUR 183

Phospho-SMC1A-S957 Rabbit pAb
AP0090-50ul	Abclonal	50 ul	EUR 265

Phospho-SMC1A-S957 Rabbit pAb
AP0204-100ul	Abclonal	100 ul	EUR 384

Phospho-SMC1A-S957 Rabbit pAb
AP0204-200ul	Abclonal	200 ul	EUR 554

Phospho-SMC1A-S957 Rabbit pAb
AP0204-20ul	Abclonal	20 ul	Ask for price

Phospho-SMC1A-S957 Rabbit pAb
AP0204-50ul	Abclonal	50 ul	EUR 265

Monoclonal SMC1A (N-terminus) Antibody
AMM03130G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human SMC1A (N-terminus). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC, FC

Monoclonal SMC1A(C-term) Antibody
AMM03131G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human SMC1A(C-term). The antibodies are raised in Mouse. This antibody is applicable in WB, ICC

Smc1a ORF Vector (Rat) (pORF)
ORF076689	ABM	1.0 ug DNA	EUR 506

SMC1A ORF Vector (Human) (pORF)
ORF032593	ABM	1.0 ug DNA	EUR 405

Smc1a ORF Vector (Mouse) (pORF)
ORF057962	ABM	1.0 ug DNA	EUR 506

Anti-Phospho-SMC1A-(S957) antibody
STJ22400	St John's Laboratory	100 µl	EUR 393
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-Phospho-SMC1A-(S957) antibody
STJ22401	St John's Laboratory	100 µl	EUR 393
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

SMC1A(N-term) Conjugated Monoclonal Antibody
C27022	SAB	100ul	EUR 397

Smc1a sgRNA CRISPR Lentivector set (Rat)
K7081601	ABM	3 x 1.0 ug	EUR 339

SMC1A sgRNA CRISPR Lentivector set (Human)
K2199801	ABM	3 x 1.0 ug	EUR 339

Smc1a sgRNA CRISPR Lentivector set (Mouse)
K3941501	ABM	3 x 1.0 ug	EUR 339

Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
20-abx005309	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx027456-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx027456-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx159694-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx159695-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx238016-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
20-abx320098	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx331418-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
20-abx325753	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Smc1a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7081602	ABM	1.0 ug DNA	EUR 154

Smc1a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7081603	ABM	1.0 ug DNA	EUR 154

Smc1a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7081604	ABM	1.0 ug DNA	EUR 154

SMC1A sgRNA CRISPR Lentivector (Human) (Target 1)
K2199802	ABM	1.0 ug DNA	EUR 154

SMC1A sgRNA CRISPR Lentivector (Human) (Target 2)
K2199803	ABM	1.0 ug DNA	EUR 154