SERPINA1

SERPINA1 Antibody
32119-100ul	SAB	100ul	EUR 252

SERPINA1 antibody
10R-5726	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5727	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5728	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5729	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5730	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5731	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
10R-5732	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SERPINA1 antibody

SERPINA1 antibody
70R-20165	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SERPINA1 antibody

SERPINA1 Antibody
DF6182	Affbiotech	200ul	EUR 304
Description: SERPINA1 Antibody detects endogenous levels of total SERPINA1.

SERPINA1 siRNA
20-abx932961	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SERPINA1 siRNA
20-abx932962	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SERPINA1 Antibody
1-CSB-PA004671	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

SERPINA1 Antibody
1-CSB-PA006124	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

SERPINA1 Antibody
1-CSB-PA799490	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

SERPINA1 Antibody
1-CSB-PA213215	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SERPINA1 Antibody
1-CSB-PA213997	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SERPINA1 Antibody
1-CSB-PA12565A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SERPINA1 Antibody
1-CSB-PA021053GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Serpina1 Antibody
1-CSB-PA021053HA01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

SERPINA1 Conjugated Antibody
C32119	SAB	100ul	EUR 397

SERPINA1 cloning plasmid
CSB-CL021053HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1257 Sequence: atgccgtcttctgtctcgtggggcatcctcctgctggcaggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccagaagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaacctggctgagttcgcct Show more
Description: A cloning plasmid for the SERPINA1 gene.

SERPINA1 Polyclonal Antibody
A64152	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SERPINA1 Rabbit pAb
A1015-100ul	Abclonal	100 ul	EUR 308

SERPINA1 Rabbit pAb
A1015-200ul	Abclonal	200 ul	EUR 459

SERPINA1 Rabbit pAb
A1015-20ul	Abclonal	20 ul	EUR 183

SERPINA1 Rabbit pAb
A1015-50ul	Abclonal	50 ul	EUR 223

SERPINA1 Rabbit pAb
A12481-100ul	Abclonal	100 ul	EUR 308

SERPINA1 Rabbit pAb
A12481-200ul	Abclonal	200 ul	EUR 459

SERPINA1 Rabbit pAb
A12481-20ul	Abclonal	20 ul	EUR 183

SERPINA1 Rabbit pAb
A12481-50ul	Abclonal	50 ul	EUR 223

Serpina1 Polyclonal Antibody
A55133	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SERPINA1 Blocking Peptide
DF6182-BP	Affbiotech	1mg	EUR 195

Recombinant Human SERPINA1
P0481	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P01009
Description: Recombinant Human protein for SERPINA1

Anti-SERPINA1 antibody
STJ400000	St John's Laboratory	1 mg	EUR 446
Description: AAT is a glycoprotein that protects the lungs from the destructive actions of blood enzymes. Disorders of this protein include AAT-deficiency leading to chronic uninhibited tissue breakdown.

Anti-SERPINA1 antibody
STJ400001	St John's Laboratory	1 mg	EUR 446
Description: AAT is a glycoprotein that protects the lungs from the destructive actions of blood enzymes. Disorders of this protein include AAT-deficiency leading to chronic uninhibited tissue breakdown.

Anti-SERPINA1 antibody
STJ25480	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.

Anti-SERPINA1 antibody
STJ114355	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.

Polyclonal SERPINA1 Antibody (Center)
AMR09901G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINA1 (Center). This antibody is tested and proven to work in the following applications:

Rat SERPINA1 shRNA Plasmid
20-abx984579	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SERPINA1 ELISA Kit
ELA-E1697h	Lifescience Market	96 Tests	EUR 824

Serpin A1 (SERPINA1) Antibody
20-abx133762	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Serpin A1 (SERPINA1) Antibody
20-abx008868	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Human SERPINA1 shRNA Plasmid
20-abx953514	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SERPINA1 recombinant monoclonal antibody
A5706	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human SERPINA1 for WB, IHC,ELISA

SERPINA1 Antibody, HRP conjugated
1-CSB-PA12565B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SERPINA1 Antibody, FITC conjugated
1-CSB-PA12565C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SERPINA1 Antibody, Biotin conjugated
1-CSB-PA12565D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Serpina1 Antibody, HRP conjugated
1-CSB-PA021053HB01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Serpina1 Antibody, FITC conjugated
1-CSB-PA021053HC01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Serpina1 Antibody, Biotin conjugated
1-CSB-PA021053HD01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

SERPINA1 Recombinant Protein (Human)
RP028120	ABM	100 ug	Ask for price

Monoclonal SERPINA1 Antibody, Clone: 6F9H11
AMR09899G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human SERPINA1. The antibodies are raised in Mouse and are from clone 6F9H11. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal SERPINA1 Antibody, Clone: 5D1D2
AMR09900G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human SERPINA1. The antibodies are raised in Mouse and are from clone 5D1D2. This antibody is applicable in WB and IHC, FC, ICC, E

Alpha-1-Antitrypsin (SERPINA1) Antibody
20-abx115459	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

alpha 1-Antiproteinase (Serpina1) Antibody
20-abx110372	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
20-abx000959	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx034372-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx034372-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

alpha 1 Antitrypsin (SERPINA1) Antibody
abx022446-1mg	Abbexa	1 mg	EUR 648
Shipped within 5-10 working days.

alpha 1 Antitrypsin (SERPINA1) Antibody
abx022447-1mg	Abbexa	1 mg	EUR 871
Shipped within 5-10 working days.

alpha 1 Antitrypsin (SERPINA1) Antibody
abx023901-02mg	Abbexa	0.2 mg	EUR 578
Shipped within 5-10 working days.

alpha 1-Antitrypsin (SERPINA1) Antibody
abx019008-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

SERPINA1 Polyclonal Antibody, HRP Conjugated
A64153	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SERPINA1 Polyclonal Antibody, FITC Conjugated
A64154	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SERPINA1 Polyclonal Antibody, Biotin Conjugated
A64155	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Alpha-1-Antitrypsin (SERPINA1) Antibody
20-abx306530	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx218526-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx224268-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx224395-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

alpha-1-Antitrypsin (SERPINA1) Antibody
abx432314-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

alpha-1-Antitrypsin (SERPINA1) Antibody
abx432315-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx411121-1mg	Abbexa	1 mg	EUR 801
Shipped within 1 week.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx230337-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Alpha-1-Antitrypsin (SERPINA1) Antibody
abx230338-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Serpina1 Polyclonal Antibody, Biotin Conjugated
A55130	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Serpina1 Polyclonal Antibody, FITC Conjugated
A55131	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Serpina1 Polyclonal Antibody, HRP Conjugated
A55132	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Rat Alpha-1-antiproteinase (Serpina1)
1-CSB-YP021053RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 45.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Alpha-1-antiproteinase(Serpina1) expressed in Yeast

Rat Alpha-1-antiproteinase (Serpina1)
1-CSB-EP021053RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 59.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Alpha-1-antiproteinase(Serpina1) expressed in E.coli

SERPINA1 ORF Vector (Human) (pORF)
ORF009374	ABM	1.0 ug DNA	EUR 95

Serpina1 ORF Vector (Rat) (pORF)
ORF076059	ABM	1.0 ug DNA	EUR 506

SERPINA1 ELISA Kit (Human) (OKAN04443)
OKAN04443	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.83 ng/mL

SERPINA1 ELISA Kit (Rat) (OKAN05381)
OKAN05381	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.5 ng/mL

SERPINA1 ELISA Kit (Rat) (OKCD07605)
OKCD07605	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: SERPINA1 is also known as PI, A1A or AAT. The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 3.5ng/mL