SEMA5B

SEMA5B siRNA
20-abx932855	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEMA5B siRNA
20-abx932856	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEMA5B Polyclonal Antibody
28364-100ul	SAB	100ul	EUR 252

SEMA5B Polyclonal Antibody
28364-50ul	SAB	50ul	EUR 187

SEMA5B Rabbit pAb
A13819-100ul	Abclonal	100 ul	EUR 308

SEMA5B Rabbit pAb
A13819-200ul	Abclonal	200 ul	EUR 459

SEMA5B Rabbit pAb
A13819-20ul	Abclonal	20 ul	EUR 183

SEMA5B Rabbit pAb
A13819-50ul	Abclonal	50 ul	EUR 223

SEMA5B cloning plasmid
CSB-CL868389HU-10ug	Cusabio	10ug	EUR 1227
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3456 Sequence: atgccctgtggcttcagtccgtctcctgttgcccaccacctcgtccctgggccgcctgataccccagcccaacagctaaggtgtggatggacagtagggggctggcttctctcactggtcaggggtcttctcccctgtctgcctcccggagctaggactgcagaggggcctatca Show more
Description: A cloning plasmid for the SEMA5B gene.

Anti-SEMA5B antibody
STJ115761	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene.

SEMA5B Antibody, HRP conjugated
1-CSB-PA868389LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEMA5B Antibody, FITC conjugated
1-CSB-PA868389LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEMA5B Antibody, Biotin conjugated
1-CSB-PA868389LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Semaphorin 5B (SEMA5B) Antibody
20-abx101369	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Semaphorin 5B (SEMA5B) Antibody
20-abx101370	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Semaphorin 5B (SEMA5B) Antibody
20-abx101371	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Semaphorin 5B (SEMA5B) Antibody
20-abx101372	Abbexa	EUR 356.00 EUR 926.00 EUR 467.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Mouse SEMA5B shRNA Plasmid
20-abx972643	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEMA5B Polyclonal Conjugated Antibody
C28364	SAB	100ul	EUR 397

Semaphorin 5B (SEMA5B) Antibody
20-abx338767	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human SEMA5B shRNA Plasmid
20-abx960055	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Semaphorin 5B (SEMA5B)
4-RPL926Hu01	Cloud-Clone	EUR 377.76 EUR 204.00 EUR 1141.60 EUR 447.20 EUR 794.40 EUR 316.00 EUR 2704.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9P283 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.9kDa Isoelectric Point: 6
Description: Recombinant Human Semaphorin 5B expressed in: E.coli

Recombinant Semaphorin 5B (SEMA5B)
4-RPL926Hu02	Cloud-Clone	EUR 377.76 EUR 204.00 EUR 1141.60 EUR 447.20 EUR 794.40 EUR 316.00 EUR 2704.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9P283 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.5kDa Isoelectric Point: 6.2
Description: Recombinant Human Semaphorin 5B expressed in: E.coli

Recombinant Semaphorin 5B (SEMA5B)
4-RPL926Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q60519 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Semaphorin 5B expressed in: E.coli

Human Semaphorin 5B (SEMA5B) Protein
20-abx069032	Abbexa	EUR 537.00 EUR 244.00 EUR 1553.00 EUR 634.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Semaphorin 5B (SEMA5B) Protein
20-abx069033	Abbexa	EUR 537.00 EUR 244.00 EUR 1553.00 EUR 634.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Semaphorin 5B (SEMA5B) Protein
20-abx069034	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Semaphorin 5B (SEMA5B) Antibody (Biotin)
20-abx271868	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Semaphorin 5B (SEMA5B) Antibody (Biotin)
20-abx272978	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Semaphorin 5B (SEMA5B) Antibody (HRP)
20-abx337585	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Semaphorin 5B (SEMA5B) Antibody (FITC)
20-abx337586	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Semaphorin 5B (SEMA5B) Antibody (Biotin)
20-abx337587	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sema5b ORF Vector (Rat) (pORF)
ORF076013	ABM	1.0 ug DNA	EUR 506

SEMA5B ORF Vector (Human) (pORF)
ORF009336	ABM	1.0 ug DNA	EUR 95

Sema5b ORF Vector (Mouse) (pORF)
ORF056912	ABM	1.0 ug DNA	EUR 506

SEMA5B ELISA Kit (Human) (OKCD09338)
OKCD09338	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.133ng/mL

Human Semaphorin 5B (SEMA5B)ELISA Kit
201-12-2276	SunredBio	96 tests	EUR 440
This Semaphorin 5B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Semaphorin- 5B, Sema5b ELISA KIT
ELI-29661m	Lifescience Market	96 Tests	EUR 865

Human Semaphorin 5B (SEMA5B) ELISA Kit
20-abx585184	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Semaphorin- 5B, SEMA5B ELISA KIT
ELI-35821h	Lifescience Market	96 Tests	EUR 824

Sema5b sgRNA CRISPR Lentivector set (Mouse)
K4666201	ABM	3 x 1.0 ug	EUR 339

Sema5b sgRNA CRISPR Lentivector set (Rat)
K6350401	ABM	3 x 1.0 ug	EUR 339

SEMA5B sgRNA CRISPR Lentivector set (Human)
K2117201	ABM	3 x 1.0 ug	EUR 339

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human)
4-MAL926Hu21	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B)

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human)
4-MAL926Hu22	Cloud-Clone	EUR 274.00 EUR 2945.00 EUR 724.00 EUR 349.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B)

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
4-PAL926Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
4-PAL926Hu02	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Gly350~Pro602) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
4-PAL926Hu03	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Mouse)
4-PAL926Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Gly836~Leu1013) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Semaphorin 5B (SEMA5B)

Human Semaphorin 5B(SEMA5B)ELISA Kit
QY-E00789	Qayee Biotechnology	96T	EUR 361

Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Semaphorin 5B (SEMA5B) ELISA Kit
4-SEL926Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Semaphorin 5B elisa. Alternative names of the recognized antigen: SEMAG SemG Sema Domain, Immunoglobulin Domain(Ig), Transmembrane Domain(TM)and Short Cytoplasmic Domain 5B
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Semaphorin 5B (SEMA5B) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4666202	ABM	1.0 ug DNA	EUR 154

Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4666203	ABM	1.0 ug DNA	EUR 154

Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4666204	ABM	1.0 ug DNA	EUR 154

Sema5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6350402	ABM	1.0 ug DNA	EUR 154

Sema5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6350403	ABM	1.0 ug DNA	EUR 154

Sema5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6350404	ABM	1.0 ug DNA	EUR 154

SEMA5B sgRNA CRISPR Lentivector (Human) (Target 1)
K2117202	ABM	1.0 ug DNA	EUR 154

SEMA5B sgRNA CRISPR Lentivector (Human) (Target 2)
K2117203	ABM	1.0 ug DNA	EUR 154

SEMA5B sgRNA CRISPR Lentivector (Human) (Target 3)
K2117204	ABM	1.0 ug DNA	EUR 154

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), APC
4-MAL926Hu21-APC	Cloud-Clone	EUR 380.00 EUR 3779.00 EUR 1038.00 EUR 490.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Biotinylated
4-MAL926Hu21-Biotin	Cloud-Clone	EUR 337.00 EUR 2829.00 EUR 819.00 EUR 417.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Cy3
4-MAL926Hu21-Cy3	Cloud-Clone	EUR 465.00 EUR 4997.00 EUR 1343.00 EUR 612.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), FITC
4-MAL926Hu21-FITC	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with FITC.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), HRP
4-MAL926Hu21-HRP	Cloud-Clone	EUR 346.00 EUR 3291.00 EUR 916.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with HRP.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), PE
4-MAL926Hu21-PE	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with PE.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), APC
4-MAL926Hu22-APC	Cloud-Clone	EUR 386.00 EUR 3869.00 EUR 1061.00 EUR 499.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Biotinylated
4-MAL926Hu22-Biotin	Cloud-Clone	EUR 342.00 EUR 2895.00 EUR 836.00 EUR 424.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Cy3
4-MAL926Hu22-Cy3	Cloud-Clone	EUR 474.00 EUR 5117.00 EUR 1373.00 EUR 624.00 EUR 274.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), FITC
4-MAL926Hu22-FITC	Cloud-Clone	EUR 329.00 EUR 3115.00 EUR 868.00 EUR 419.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with FITC.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), HRP
4-MAL926Hu22-HRP	Cloud-Clone	EUR 351.00 EUR 3369.00 EUR 936.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with HRP.

Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), PE
4-MAL926Hu22-PE	Cloud-Clone	EUR 329.00 EUR 3115.00 EUR 868.00 EUR 419.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly350~Pro602 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with PE.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), APC
4-PAL926Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), Biotinylated
4-PAL926Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), Cy3
4-PAL926Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), FITC
4-PAL926Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with FITC.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), HRP
4-PAL926Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with HRP.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), PE
4-PAL926Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Leu36~Glu161) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with PE.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), APC
4-PAL926Hu02-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Gly350~Pro602) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), Biotinylated
4-PAL926Hu02-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Gly350~Pro602) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.

Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human), Cy3
4-PAL926Hu02-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SEMA5B (Gly350~Pro602) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.