SEC61G

SEC61G Antibody
DF12136	Affbiotech	200ul	EUR 304
Description: SEC61G antibody detects endogenous levels of SEC61G.

SEC61G Antibody
1-CSB-PA03509A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SEC61G Antibody
1-CSB-PA020959GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SEC61G siRNA
20-abx932790	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC61G siRNA
20-abx932791	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC61G Blocking Peptide
DF12136-BP	Affbiotech	1mg	EUR 195

SEC61G cloning plasmid
CSB-CL020959HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 207 Sequence: atggatcaggtaatgcagtttgttgagccaagtcggcagtttgtaaaggactccattcggctggttaaaagatgcactaaacctgatagaaaagaattccagaagattgccatggcaacagcaataggatttgctataatgggattcattggcttctttgtgaaattgatccatat Show more
Description: A cloning plasmid for the SEC61G gene.

SEC61G Polyclonal Antibody
A60846	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

anti- SEC61G antibody
FNab07692	FN Test	100µg	EUR 548.75
Immunogen: Sec61 gamma subunit Uniprot ID: P60059 Gene ID: 23480 Research Area: Metabolism
Description: Antibody raised against SEC61G

Anti-SEC61G antibody
PAab07692	Lifescience Market	100 ug	EUR 386

SEC61G Antibody, HRP conjugated
1-CSB-PA03509B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEC61G Antibody, FITC conjugated
1-CSB-PA03509C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEC61G Antibody, Biotin conjugated
1-CSB-PA03509D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Sec61g ELISA KIT
ELI-13406m	Lifescience Market	96 Tests	EUR 865

Human SEC61G ELISA KIT
ELI-15491h	Lifescience Market	96 Tests	EUR 824

Bovine SEC61G ELISA KIT
ELI-29480b	Lifescience Market	96 Tests	EUR 928

SEC61G ELISA KIT\|Human
EF002797	Lifescience Market	96 Tests	EUR 689

Mouse SEC61G shRNA Plasmid
20-abx972625	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SEC61G shRNA Plasmid
20-abx958298	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine SEC61G ELISA KIT
ELI-40861d	Lifescience Market	96 Tests	EUR 928

SEC61G Recombinant Protein (Human)
RP027925	ABM	100 ug	Ask for price

SEC61G Recombinant Protein (Rat)
RP227921	ABM	100 ug	Ask for price

SEC61G Recombinant Protein (Mouse)
RP170597	ABM	100 ug	Ask for price

SEC61G Recombinant Protein (Mouse)
RP170600	ABM	100 ug	Ask for price

SEC61G Recombinant Protein (Mouse)
RP170603	ABM	100 ug	Ask for price

SEC61G Polyclonal Antibody, Biotin Conjugated
A60847	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SEC61G Polyclonal Antibody, FITC Conjugated
A60848	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SEC61G Polyclonal Antibody, HRP Conjugated
A60849	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Sec61g ORF Vector (Rat) (pORF)
ORF075975	ABM	1.0 ug DNA	EUR 506

SEC61G ORF Vector (Human) (pORF)
ORF009309	ABM	1.0 ug DNA	EUR 95

Sec61g ORF Vector (Mouse) (pORF)
ORF056867	ABM	1.0 ug DNA	EUR 506

Sec61g ORF Vector (Mouse) (pORF)
ORF056868	ABM	1.0 ug DNA	EUR 506

Sec61g ORF Vector (Mouse) (pORF)
ORF056869	ABM	1.0 ug DNA	EUR 506

Sec61 Translocon Gamma Subunit (SEC61G) Antibody
20-abx210206	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sec61 Translocon Gamma Subunit (SEC61G) Antibody
abx237692-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sec61g sgRNA CRISPR Lentivector set (Rat)
K6065701	ABM	3 x 1.0 ug	EUR 339

Sec61g sgRNA CRISPR Lentivector set (Mouse)
K4975501	ABM	3 x 1.0 ug	EUR 339

SEC61G sgRNA CRISPR Lentivector set (Human)
K2114401	ABM	3 x 1.0 ug	EUR 339

Sec61 Translocon Gamma Subunit (SEC61G) Antibody (HRP)
20-abx210207	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sec61 Translocon Gamma Subunit (SEC61G) Antibody (FITC)
20-abx210208	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sec61 Translocon Gamma Subunit (SEC61G) Antibody (Biotin)
20-abx210209	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sec61g sgRNA CRISPR Lentivector (Rat) (Target 1)
K6065702	ABM	1.0 ug DNA	EUR 154

Sec61g sgRNA CRISPR Lentivector (Rat) (Target 2)
K6065703	ABM	1.0 ug DNA	EUR 154

Sec61g sgRNA CRISPR Lentivector (Rat) (Target 3)
K6065704	ABM	1.0 ug DNA	EUR 154

Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4975502	ABM	1.0 ug DNA	EUR 154

Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4975503	ABM	1.0 ug DNA	EUR 154

Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4975504	ABM	1.0 ug DNA	EUR 154

SEC61G sgRNA CRISPR Lentivector (Human) (Target 1)
K2114402	ABM	1.0 ug DNA	EUR 154

SEC61G sgRNA CRISPR Lentivector (Human) (Target 2)
K2114403	ABM	1.0 ug DNA	EUR 154

SEC61G sgRNA CRISPR Lentivector (Human) (Target 3)
K2114404	ABM	1.0 ug DNA	EUR 154

SEC61G Protein Vector (Rat) (pPB-C-His)
PV303898	ABM	500 ng	EUR 603

SEC61G Protein Vector (Rat) (pPB-N-His)
PV303899	ABM	500 ng	EUR 603

SEC61G Protein Vector (Rat) (pPM-C-HA)
PV303900	ABM	500 ng	EUR 603

SEC61G Protein Vector (Rat) (pPM-C-His)
PV303901	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227466	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227467	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227468	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227469	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227470	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227471	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227472	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227473	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227474	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227475	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227476	ABM	500 ng	EUR 603

SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227477	ABM	500 ng	EUR 603

SEC61G Protein Vector (Human) (pPB-C-His)
PV037233	ABM	500 ng	EUR 329

SEC61G Protein Vector (Human) (pPB-N-His)
PV037234	ABM	500 ng	EUR 329

SEC61G Protein Vector (Human) (pPM-C-HA)
PV037235	ABM	500 ng	EUR 329

SEC61G Protein Vector (Human) (pPM-C-His)
PV037236	ABM	500 ng	EUR 329

Sec61g 3'UTR Luciferase Stable Cell Line
TU118509	ABM	1.0 ml	Ask for price

Sec61g 3'UTR GFP Stable Cell Line
TU168509	ABM	1.0 ml	Ask for price

Sec61g 3'UTR Luciferase Stable Cell Line
TU220071	ABM	1.0 ml	Ask for price

Sec61g 3'UTR GFP Stable Cell Line
TU270071	ABM	1.0 ml	Ask for price

SEC61G 3'UTR GFP Stable Cell Line
TU072847	ABM	1.0 ml	EUR 1394

SEC61G 3'UTR Luciferase Stable Cell Line
TU022847	ABM	1.0 ml	EUR 1394

Human Sec61 Translocon Gamma Subunit (SEC61G) ELISA Kit
abx383091-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6065705	ABM	3 x 1.0 ug	EUR 376

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4975505	ABM	3 x 1.0 ug	EUR 376

SEC61G sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2114405	ABM	3 x 1.0 ug	EUR 376

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6065706	ABM	1.0 ug DNA	EUR 167

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6065707	ABM	1.0 ug DNA	EUR 167

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6065708	ABM	1.0 ug DNA	EUR 167

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4975506	ABM	1.0 ug DNA	EUR 167

Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4975507	ABM	1.0 ug DNA	EUR 167