SEC24C

SEC24C siRNA
20-abx932778	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC24C Antibody
1-CSB-PA020952GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SEC24C Antibody
1-CSB-PA020952LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Human Protein transport protein Sec24C, SEC24C ELISA KIT
ELI-13439h	Lifescience Market	96 Tests	EUR 824

SEC24C cloning plasmid
CSB-CL020952HU-10ug	Cusabio	10ug	EUR 1204
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3285 Sequence: atgaacgtcaaccagtcagttccacctgtgccaccatttgggcagccccagcccatctacccagggtatcatcagtccagctatggtgggcaatcagggtccacagcccccgccattccctatggagcctacaatggcccagtaccaggctatcagcaaacacctccccaaggta Show more
Description: A cloning plasmid for the SEC24C gene.

anti- SEC24C antibody
FNab07682	FN Test	100µg	EUR 548.75
Immunogen: SEC24 family, member C(S. cerevisiae) Uniprot ID: P53992 Gene ID: 9632 Research Area: Metabolism
Description: Antibody raised against SEC24C

SEC24C Rabbit pAb
A10797-100ul	Abclonal	100 ul	EUR 308

SEC24C Rabbit pAb
A10797-200ul	Abclonal	200 ul	EUR 459

SEC24C Rabbit pAb
A10797-20ul	Abclonal	20 ul	EUR 183

SEC24C Rabbit pAb
A10797-50ul	Abclonal	50 ul	EUR 223

SEC24C Polyclonal Antibody
A60838	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SEC24C Rabbit pAb
A9159-100ul	Abclonal	100 ul	EUR 308

SEC24C Rabbit pAb
A9159-200ul	Abclonal	200 ul	EUR 459

SEC24C Rabbit pAb
A9159-20ul	Abclonal	20 ul	Ask for price

SEC24C Rabbit pAb
A9159-50ul	Abclonal	50 ul	Ask for price

SEC24C Polyclonal Antibody
27501-100ul	SAB	100ul	EUR 252

SEC24C Polyclonal Antibody
27501-50ul	SAB	50ul	EUR 187

Anti-SEC24C antibody
PAab07682	Lifescience Market	100 ug	EUR 386

pDONR223-SEC24C Plasmid
PVTB00920	Lifescience Market	2 ug	EUR 356

Anti-SEC24C Antibody
STJ502900	St John's Laboratory	100 µg	EUR 476

Anti-SEC24C antibody
STJ111590	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.

Anti-SEC24C antibody
STJ112693	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.

Polyclonal SEC24C Antibody (Center)
AMM07743G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC24C (Center). This antibody is tested and proven to work in the following applications:

SEC24C Polyclonal Conjugated Antibody
C27501	SAB	100ul	EUR 397

SEC24C ELISA KIT|Human
EF002791	Lifescience Market	96 Tests	EUR 689

Human SEC24C shRNA Plasmid
20-abx956411	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC24C Antibody, HRP conjugated
1-CSB-PA020952LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEC24C Antibody, FITC conjugated
1-CSB-PA020952LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEC24C Antibody, Biotin conjugated
1-CSB-PA020952LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SEC24C Antibody BIOTIN
STJ502901	St John's Laboratory	100 µg	EUR 586

Anti-SEC24C Antibody FITC
STJ502902	St John's Laboratory	100 µg	EUR 586

SEC24C Polyclonal Antibody, Biotin Conjugated
A60839	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SEC24C Polyclonal Antibody, FITC Conjugated
A60840	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SEC24C Polyclonal Antibody, HRP Conjugated
A60841	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SEC24C ORF Vector (Human) (pORF)
ORF009303	ABM	1.0 ug DNA	EUR 95

Sec24c ORF Vector (Mouse) (pORF)
ORF056859	ABM	1.0 ug DNA	EUR 506

Sec24c ORF Vector (Mouse) (pORF)
ORF056860	ABM	1.0 ug DNA	EUR 506

Sec24c ORF Vector (Rat) (pORF)
ORF075968	ABM	1.0 ug DNA	EUR 506

SEC24C sgRNA CRISPR Lentivector set (Human)
K2113701	ABM	3 x 1.0 ug	EUR 339

Sec24c sgRNA CRISPR Lentivector set (Mouse)
K4683701	ABM	3 x 1.0 ug	EUR 339

Sec24c sgRNA CRISPR Lentivector set (Rat)
K6600201	ABM	3 x 1.0 ug	EUR 339

SEC24C sgRNA CRISPR Lentivector (Human) (Target 1)
K2113702	ABM	1.0 ug DNA	EUR 154

SEC24C sgRNA CRISPR Lentivector (Human) (Target 2)
K2113703	ABM	1.0 ug DNA	EUR 154

SEC24C sgRNA CRISPR Lentivector (Human) (Target 3)
K2113704	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4683702	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4683703	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4683704	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6600202	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6600203	ABM	1.0 ug DNA	EUR 154

Sec24c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6600204	ABM	1.0 ug DNA	EUR 154

SEC24C Protein Vector (Human) (pPB-C-His)
PV037209	ABM	500 ng	EUR 329

SEC24C Protein Vector (Human) (pPB-N-His)
PV037210	ABM	500 ng	EUR 329

SEC24C Protein Vector (Human) (pPM-C-HA)
PV037211	ABM	500 ng	EUR 329

SEC24C Protein Vector (Human) (pPM-C-His)
PV037212	ABM	500 ng	EUR 329

SEC24C Protein Vector (Rat) (pPB-C-His)
PV303870	ABM	500 ng	EUR 1191

SEC24C Protein Vector (Rat) (pPB-N-His)
PV303871	ABM	500 ng	EUR 1191

SEC24C Protein Vector (Rat) (pPM-C-HA)
PV303872	ABM	500 ng	EUR 1191

SEC24C Protein Vector (Rat) (pPM-C-His)
PV303873	ABM	500 ng	EUR 1191

SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227434	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227435	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227436	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227437	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227438	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227439	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227440	ABM	500 ng	EUR 1065

SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227441	ABM	500 ng	EUR 1065

Sec24c 3'UTR GFP Stable Cell Line
TU168502	ABM	1.0 ml	Ask for price

SEC24C 3'UTR Luciferase Stable Cell Line
TU022840	ABM	1.0 ml	EUR 1521

Sec24c 3'UTR Luciferase Stable Cell Line
TU118502	ABM	1.0 ml	Ask for price

SEC24C 3'UTR GFP Stable Cell Line
TU072840	ABM	1.0 ml	EUR 1521

Sec24c 3'UTR Luciferase Stable Cell Line
TU220064	ABM	1.0 ml	Ask for price

Sec24c 3'UTR GFP Stable Cell Line
TU270064	ABM	1.0 ml	Ask for price

Human SEC24 Family Member C (SEC24C) ELISA Kit
20-abx383088	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.

for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.

for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.

for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for SEC24 Family, Member C (SEC24C)
4-SEP697Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as SEC24 Family, Member C elisa. Alternative names of the recognized antigen: SEC24-related protein C Protein transport protein Sec24C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of SEC24 Family, Member C (SEC24C) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx124157	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx126522	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx122216-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx237682-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx305272	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.