SAMM50

SAMM50 siRNA
20-abx904771	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SAMM50 Antibody
47197-100ul	SAB	100ul	EUR 252

SAMM50 antibody
70R-20079	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SAMM50 antibody

SAMM50 siRNA
20-abx932440	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SAMM50 siRNA
20-abx932441	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SAMM50 Antibody
1-CSB-PA896898ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SAMM50. Recognizes SAMM50 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SAMM50 Antibody
DF12729	Affbiotech	200ul	EUR 304
Description: SAMM50 Antibody detects endogenous levels of SAMM50.

SAMM50 Antibody
1-CSB-PA020692GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SAMM50. Recognizes SAMM50 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SAMM50 Sorting And Assembly Machinery Component (Samm50) Antibody
20-abx115733	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
20-abx002435	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx030839-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx030839-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
20-abx322601	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx237593-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SAMM50 Conjugated Antibody
C47197	SAB	100ul	EUR 397

anti- SAMM50 antibody
FNab07593	FN Test	100µg	EUR 548.75
Immunogen: sorting and assembly machinery component 50 homolog(S. cerevisiae) Uniprot ID: Q9Y512 Gene ID: 25813 Research Area: Metabolism, Signal Transduction
Description: Antibody raised against SAMM50

SAMM50 Rabbit pAb
A3401-100ul	Abclonal	100 ul	EUR 308

SAMM50 Rabbit pAb
A3401-200ul	Abclonal	200 ul	EUR 459

SAMM50 Rabbit pAb
A3401-20ul	Abclonal	20 ul	EUR 183

SAMM50 Rabbit pAb
A3401-50ul	Abclonal	50 ul	EUR 223

SAMM50 Blocking Peptide
DF12729-BP	Affbiotech	1mg	EUR 195

SAMM50 cloning plasmid
CSB-CL896898HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1410 Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta Show more
Description: A cloning plasmid for the SAMM50 gene.

SAMM50 cloning plasmid
CSB-CL896898HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1410 Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta Show more
Description: A cloning plasmid for the SAMM50 gene.

SAMM50 cloning plasmid
CSB-CL896898HU3-10ug	Cusabio	10ug	EUR 503
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1407 Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta Show more
Description: A cloning plasmid for the SAMM50 gene.

Anti-SAMM50 antibody
PAab07593	Lifescience Market	100 ug	EUR 386

Anti-SAMM50 antibody
STJ25440	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.

Anti-SAMM50 (2A9)
YF-MA18004	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SAMM50

Human SAMM50 Sorting And Assembly Machinery Component (SAMM50) ELISA Kit
abx383019-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Polyclonal SAMM50 Antibody (Center)
AMR09809G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAMM50 (Center). This antibody is tested and proven to work in the following applications:

Mouse SAMM50 shRNA Plasmid
20-abx976692	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SAMM50 shRNA Plasmid
20-abx989030	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SAMM50 ELISA KIT
ELI-18886h	Lifescience Market	96 Tests	EUR 824

SAMM50 ELISA KIT|Human
EF002708	Lifescience Market	96 Tests	EUR 689

Bovine SAMM50 ELISA KIT
ELI-45454b	Lifescience Market	96 Tests	EUR 928

Mouse Samm50 ELISA KIT
ELI-40818m	Lifescience Market	96 Tests	EUR 865

Human SAMM50 shRNA Plasmid
20-abx958513	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SAMM50 Recombinant Protein (Human)
RP027568	ABM	100 ug	Ask for price

SAMM50 Recombinant Protein (Human)
RP027571	ABM	100 ug	Ask for price

SAMM50 Recombinant Protein (Human)
RP027574	ABM	100 ug	Ask for price

SAMM50 Recombinant Protein (Rat)
RP227453	ABM	100 ug	Ask for price

SAMM50 Recombinant Protein (Mouse)
RP169967	ABM	100 ug	Ask for price

SAMM50 ORF Vector (Human) (pORF)
ORF009190	ABM	1.0 ug DNA	EUR 95

SAMM50 ORF Vector (Human) (pORF)
ORF009191	ABM	1.0 ug DNA	EUR 95

SAMM50 ORF Vector (Human) (pORF)
ORF009192	ABM	1.0 ug DNA	EUR 95

Samm50 ORF Vector (Mouse) (pORF)
ORF056657	ABM	1.0 ug DNA	EUR 506

Samm50 ORF Vector (Rat) (pORF)
ORF075819	ABM	1.0 ug DNA	EUR 506

Polyclonal SAMM50 Antibody - N-terminal region
AMR09811G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAMM50 - N-terminal region. This antibody is tested and proven to work in the following applications:

SAMM50 sgRNA CRISPR Lentivector set (Human)
K2088101	ABM	3 x 1.0 ug	EUR 339

Samm50 sgRNA CRISPR Lentivector set (Mouse)
K4593201	ABM	3 x 1.0 ug	EUR 339

Samm50 sgRNA CRISPR Lentivector set (Rat)
K7443401	ABM	3 x 1.0 ug	EUR 339

Monoclonal SAMM50 Antibody (monoclonal) (M04), Clone: 2A9
AMR09810G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human SAMM50 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 2A9. This antibody is applicable in WB

SAMM50 sgRNA CRISPR Lentivector (Human) (Target 1)
K2088102	ABM	1.0 ug DNA	EUR 154

SAMM50 sgRNA CRISPR Lentivector (Human) (Target 2)
K2088103	ABM	1.0 ug DNA	EUR 154

SAMM50 sgRNA CRISPR Lentivector (Human) (Target 3)
K2088104	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4593202	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4593203	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4593204	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7443402	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7443403	ABM	1.0 ug DNA	EUR 154

Samm50 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7443404	ABM	1.0 ug DNA	EUR 154

SAMM50 Protein Vector (Human) (pPB-C-His)
PV036757	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPB-N-His)
PV036758	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036759	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-His)
PV036760	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPB-C-His)
PV036761	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPB-N-His)
PV036762	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036763	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-His)
PV036764	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPB-C-His)
PV036765	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPB-N-His)
PV036766	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036767	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Human) (pPM-C-His)
PV036768	ABM	500 ng	EUR 329

SAMM50 Protein Vector (Rat) (pPB-C-His)
PV303274	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Rat) (pPB-N-His)
PV303275	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Rat) (pPM-C-HA)
PV303276	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Rat) (pPM-C-His)
PV303277	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Mouse) (pPB-C-His)
PV226626	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Mouse) (pPB-N-His)
PV226627	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Mouse) (pPM-C-HA)
PV226628	ABM	500 ng	EUR 603

SAMM50 Protein Vector (Mouse) (pPM-C-His)
PV226629	ABM	500 ng	EUR 603

Samm50 3'UTR GFP Stable Cell Line
TU168337	ABM	1.0 ml	Ask for price

SAMM50 3'UTR Luciferase Stable Cell Line
TU022580	ABM	1.0 ml	EUR 1394

Samm50 3'UTR Luciferase Stable Cell Line
TU118337	ABM	1.0 ml	Ask for price

SAMM50 3'UTR GFP Stable Cell Line
TU072580	ABM	1.0 ml	EUR 1394

Samm50 3'UTR Luciferase Stable Cell Line
TU219909	ABM	1.0 ml	Ask for price