SAA1

SAA1 protein
30R-2980 10 ug
EUR 241
Description: Purified recombinant Monkey SAA1 protein
SAA1 antibody
38275-100ul 100ul
EUR 252
SAA1 Antibody
10R-11514 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies
SAA1 Antibody
10R-11515 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies
SAA1 Antibody
10R-11516 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies
SAA1 Antibody
10R-11517 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies
SAA1 Antibody
1-CSB-PA14047A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
SAA1 Antibody
1-CSB-PA020656LA01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Dog. This antibody is Unconjugated. Tested in the following application: ELISA
SAA1 siRNA
20-abx932382
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SAA1 siRNA
20-abx932383
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SAA1 Antibody
ABD6533 100 ug
EUR 438
SAA1 Rabbit pAb
A14553-100ul 100 ul
EUR 308
SAA1 Rabbit pAb
A14553-200ul 200 ul
EUR 459
SAA1 Rabbit pAb
A14553-20ul 20 ul
EUR 183
SAA1 Rabbit pAb
A14553-50ul 50 ul
EUR 223
SAA1 monkey, recombinant
4332-10
EUR 343
SAA1 monkey, recombinant
4332-1000
EUR 7162
SAA1 monkey, recombinant
4332-50
EUR 958
SAA1/2 Antibody
DF6533 200ul
EUR 304
Description: SAA1 Antibody detects endogenous levels of total SAA1/2.
Human SAA1 Protein
abx060040-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.
SAA1 Conjugated Antibody
C38275 100ul
EUR 397
SAA1 cloning plasmid
CSB-CL365776HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgaagcttctcacgggcctggttttctgctccttggtcctgggtgtcagcagccgaagcttcttttcgttccttggcgaggcttttgatggggctcgggacatgtggagagcctactctgacatgagagaagccaattacatcggctcagacaaatacttccatgctcgggggaa
  • Show more
Description: A cloning plasmid for the SAA1 gene.
SAA1 Polyclonal Antibody
A52372 100 µg
EUR 570.55
Description: Ask the seller for details
SAA1 Polyclonal Antibody
A55926 100 µg
EUR 570.55
Description: kits suitable for this type of research
SAA1 Rabbit pAb
A1655-100ul 100 ul
EUR 308
SAA1 Rabbit pAb
A1655-200ul 200 ul
EUR 459
SAA1 Rabbit pAb
A1655-20ul 20 ul
EUR 183
SAA1 Rabbit pAb
A1655-50ul 50 ul
EUR 223
SAA1 Polyclonal Antibody
ABP60318-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein
SAA1 Polyclonal Antibody
ABP60318-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein
SAA1 Polyclonal Antibody
ABP60318-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein
anti- SAA1 antibody
FNab07572 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: serum amyloid A1
  • Uniprot ID: P0DJI8
  • Gene ID: 6288
  • Research Area: Cardiovascular
Description: Antibody raised against SAA1
SAA1 Polyclonal Antibody
ES11982-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SAA1 Polyclonal Antibody
ES11982-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-SAA1 antibody
PAab07572 100 ug
EUR 412
Anti-SAA1 antibody
STJ25438 100 µl
EUR 277
Description: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.
Anti-SAA1 antibody
STJ116764 100 µl
EUR 277
Description: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.
Anti-SAA1 antibody
STJ160130 1 mL C
EUR 1647
Anti-SAA1 antibody
STJ400172 1 mg
EUR 446
Description: Serum amyloid A, a family of apolipoproteins, is associated with high density lipoprotein during inflammatory states. The level of serum amyloid A (SAA) in the blood increases dramatically in response to tissue injury and inflammation. SAA also acts as a cytokine, influencing cell adhesion, migration, proliferation and aggregation. SAAs are implicated in several chronic inflammatory diseases, such as amyloidosis, atherosclerosis, and rheumatoid arthritis.
Anti-SAA1 antibody
STJ400173 1 mg
EUR 446
Description: Serum amyloid A, a family of apolipoproteins, is associated with high density lipoprotein during inflammatory states. The level of serum amyloid A (SAA) in the blood increases dramatically in response to tissue injury and inflammation. SAA also acts as a cytokine, influencing cell adhesion, migration, proliferation and aggregation. SAAs are implicated in several chronic inflammatory diseases, such as amyloidosis, atherosclerosis, and rheumatoid arthritis.
Anti-SAA1 antibody
STJ193140 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SAA1
SAA1 Antibody, HRP conjugated
1-CSB-PA14047B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SAA1 Antibody, FITC conjugated
1-CSB-PA14047C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SAA1 Antibody, Biotin conjugated
1-CSB-PA14047D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SAA1/2 Blocking Peptide
DF6533-BP 1mg
EUR 195
Human SAA1 ELISA Kit
ELA-E0885h 96 Tests
EUR 824
Serum Amyloid A1/SAA1
E21-633 10ug
EUR 343
Canine SAA1 ELISA KIT
ELI-02982d 96 Tests
EUR 928
Mouse SAA1 shRNA Plasmid
20-abx972558
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SAA1 Antibody, HRP conjugated
1-CSB-PA020656LB01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA
SAA1 Antibody, FITC conjugated
1-CSB-PA020656LC01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA
SAA1 Antibody, Biotin conjugated
1-CSB-PA020656LD01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SAA1 shRNA Plasmid
20-abx954235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Apo-SAA1, Human Recombinant
P1284-10
EUR 175
Apo-SAA1, Human Recombinant
P1284-50
EUR 370
Recombinant Human SAA1 Protein
RP01095 10 μg
EUR 228
SAA1 Recombinant Protein (Human)
RP027535 100 ug Ask for price
SAA1 Recombinant Protein (Mouse)
RP169859 100 ug Ask for price
Rat SAA1 ELISA Kit
STJ150392 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of SAA in Rat serum, plasma and other biological fluids
SAA1, monkey (rhesus macaque)
RC326-12 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other
Horse Serum amyloid A (SAA1)
1-CSB-YP020656HO
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Horse Serum amyloid A(SAA1) expressed in Yeast
Polyclonal Saa1 Antibody - middle region
APR01027G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Saa1 - middle region. This antibody is tested and proven to work in the following applications:
SAA1 Polyclonal Antibody, Biotin Conjugated
A52369 100 µg
EUR 570.55
Description: reagents widely cited
SAA1 Polyclonal Antibody, FITC Conjugated
A52370 100 µg
EUR 570.55
Description: Ask the seller for details
SAA1 Polyclonal Antibody, HRP Conjugated
A52371 100 µg
EUR 570.55
Description: The best epigenetics products
SAA1 Polyclonal Antibody, HRP Conjugated
A55927 100 µg
EUR 570.55
Description: fast delivery possible
SAA1 Polyclonal Antibody, FITC Conjugated
A55928 100 µg
EUR 570.55
Description: reagents widely cited
SAA1 Polyclonal Antibody, Biotin Conjugated
A55929 100 µg
EUR 570.55
Description: Ask the seller for details
m SAA1 inducible lentiviral particles
LVP547 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing mouse target: m SAA1 (alternative name: Saa-1; Saa2). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009117. Particles also contains a RFP-Blasticidin dual selection marker.
SAA1 ORF Vector (Human) (pORF)
ORF009179 1.0 ug DNA
EUR 95
Saa1 ORF Vector (Mouse) (pORF)
ORF056621 1.0 ug DNA
EUR 95
Recombinant Human Apo-SAA1 Protein
PROTP0DJI8-3 50ug
EUR 317
Description: Serum amyloid A proteins (SAA) represents a family of apolipoproteins that circulates in association with high-density lipoproteins (HDL). The level of apo-SAA, normally 1-5 μg/ml in plasma, increases 500-1000 fold within 24 hours of an inflammatory stimulus and, under these conditions, is the most abundant HDL apo-lipoprotein. The human SAA gene codes for a 122 amino acid nonglycosylated polypeptide, which contains an 18 amino acid N-terminal sequence. Recombinant human apo-SAA1 is an 11.7 kDa protein containing 105 amino acid residues.
SAA1 ELISA Kit (Mouse) (OKAN04481)
OKAN04481 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.67 ng/mL
SAA1 ELISA Kit (Human) (OKBB01074)
OKBB01074 96 Wells
EUR 505
Description: Description of target: Serum amyloid A protein (SAA), also known as SAA1, is a protein that in humans is encoded by the SAA1 gene. This gene encodes a member of the serum amyloid A family of apolipoproteins. It is mapped to 11p15.1. SAA is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <150pg/ml
SAA1 ELISA Kit (Horse) (OKCA01072)
OKCA01072 96 Wells
EUR 930
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex. ;Species reactivity: Horse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL
SAA1 ELISA Kit (Rabbit) (OKCD00258)
OKCD00258 96 Wells
EUR 857
Description: Description of target: Major acute phase protein.By similarity ;Species reactivity: Rabbit;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.069 ng/mL
SAA1 ELISA Kit (Bovine) (OKCD06944)
OKCD06944 96 Wells
EUR 1040
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 0.067ng/mL
SAA1 ELISA Kit (Human) (OKCD06946)
OKCD06946 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.66ng/mL
SAA1 ELISA Kit (Mouse) (OKCD06947)
OKCD06947 96 Wells
EUR 779
Description: Description of target: Major acute phase protein.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.67ng/mL
SAA1 ELISA Kit (Mouse) (OKEI00543)
OKEI00543 96 Wells
EUR 767
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL
SAA1 ELISA Kit (Horse) (OKIA00045)
OKIA00045 96 Wells
EUR 701
Description: Description of target: ;Species reactivity: Horse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.962 ng/ml
SAA1 ELISA Kit (Bovine) (OKEH03885)
OKEH03885 96 Wells
EUR 844
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.48 ng/mL
SAA1 ELISA Kit (Dog) (OKEH03972)
OKEH03972 96 Wells
EUR 844
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.36 ng/mL
SAA1 ELISA Kit (Mouse) (OKEH04394)
OKEH04394 96 Wells
EUR 662
Description: Description of target: Major acute phase protein.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4 ng/mL
Bovine Serum amyloid A protein (SAA1)
1-CSB-EP020656BO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Serum amyloid A protein(SAA1) expressed in E.coli