RPS6

RPS6 antibody
70R-10315 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RPS6 antibody
RPS6 antibody
70R-20015 50 ul
EUR 435
Description: Rabbit polyclonal RPS6 antibody
RPS6 Antibody
1-CSB-PA004005
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000
RPS6 Antibody
1-CSB-PA004006
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000
RPS6 Antibody
1-CSB-PA040250
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
rpS6 antibody
70R-34575 100 ug
EUR 327
Description: Rabbit polyclonal rpS6 antibody
RPS6 antibody
70R-51631 100 ul
EUR 287
Description: Purified Polyclonal RPS6 antibody
RPS6 Antibody
1-CSB-PA020463GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RPS6 Antibody
1-CSB-PA020463LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
RPS6 siRNA
20-abx904713
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS6 siRNA
20-abx932110
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS6 siRNA
20-abx932111
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-RPS6
PVT18296 2 ug
EUR 231
anti-RPS6
YF-PA24620 50 ul
EUR 334
Description: Mouse polyclonal to RPS6
RPS6 Polyclonal Antibody
30697-100ul 100ul
EUR 252
RPS6 Polyclonal Antibody
30697-50ul 50ul
EUR 187
RPS6 Blocking Peptide
33R-4485 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS6 antibody, catalog no. 70R-10315
Anti-RPS6 Antibody
A01567-1 100ug/vial
EUR 334
RPS6 (pS240) Antibody
20-abx121718
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
RPS6 (pS235) Antibody
20-abx133808
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
RPS6 Blocking Peptide
20-abx161429
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS6 Blocking Peptide
20-abx061734
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS6 cloning plasmid
CSB-CL020463HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca
  • Show more
Description: A cloning plasmid for the RPS6 gene.
RPS6 cloning plasmid
CSB-CL020463HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca
  • Show more
Description: A cloning plasmid for the RPS6 gene.
RPS6 cloning plasmid
CSB-CL020463HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca
  • Show more
Description: A cloning plasmid for the RPS6 gene.
RPS6 Rabbit pAb
A6058-100ul 100 ul
EUR 308
RPS6 Rabbit pAb
A6058-200ul 200 ul
EUR 459
RPS6 Rabbit pAb
A6058-20ul 20 ul
EUR 183
RPS6 Rabbit pAb
A6058-50ul 50 ul
EUR 223
RPS6 (pS235) Antibody
20-abx000279
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti- RPS6 antibody
FNab07482 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ribosomal protein S6
  • Uniprot ID: P62753
  • Gene ID: 6194
  • Research Area: Metabolism
Description: Antibody raised against RPS6
Anti-RPS6 antibody
PAab07482 100 ug
EUR 386
Anti-RPS6 antibody
STJ27852 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 40S subunit. The protein belongs to the S6E family of ribosomal proteins. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases. Phosphorylation is induced by a wide range of stimuli, including growth factors, tumor-promoting agents, and mitogens. Dephosphorylation occurs at growth arrest. The protein may contribute to the control of cell growth and proliferation through the selective translation of particular classes of mRNA. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
Anti-RPS6 antibody
STJ140049 200 µg
EUR 219
Description: Goat polyclonal to RPS6. Ribosomal protein S6 is a component of the 40S ribosomal subunit and is therefore involved in regulating translation – ribosome marker. Studies have also shown to be involved in cell proliferation, regulation of cell size and glucose homeostasis. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases.
Anti-RPS6 Antibody
A1995-100 100 µl
EUR 374
RPS6 (Ab-235) Antibody
CSB-PA061819-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RPS6 (Ab-235). Recognizes RPS6 (Ab-235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200
RPS6 (Ab-235) Antibody
CSB-PA061819-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RPS6 (Ab-235). Recognizes RPS6 (Ab-235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200
Phospho-RPS6 (S235) Antibody
1-CSB-PA040247
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RPS6 (S235). Recognizes Phospho-RPS6 (S235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000
Phospho-RPS6 (S240) Antibody
1-CSB-PA040249
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RPS6 (S240). Recognizes Phospho-RPS6 (S240) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000
Phospho-RPS6 (Ser235) Antibody
CSB-PA178097-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235). Recognizes Phospho-RPS6 (Ser235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
Phospho-RPS6 (Ser235) Antibody
CSB-PA178097-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235). Recognizes Phospho-RPS6 (Ser235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
rpS6 antibody (Ser235+Ser236)
70R-34574 100 ug
EUR 327
Description: Rabbit polyclonal rpS6 antibody (Ser235+Ser236)
RPS6 (pS235 / 236) Antibody
20-abx123581
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RPS6 (pS240 / 244) Antibody
20-abx123582
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RPS6 (pS240) Blocking Peptide
20-abx161428
  • EUR 885.00
  • EUR 2124.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS6 (pS235) Blocking Peptide
20-abx162174
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS6 ELISA KIT|Human
EF002636 96 Tests
EUR 689
Mouse RPS6 shRNA Plasmid
20-abx972521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS6 shRNA Plasmid
20-abx985414
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS6 Polyclonal Conjugated Antibody
C30697 100ul
EUR 397
RPS6 Antibody, HRP conjugated
1-CSB-PA020463LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS6 Antibody, FITC conjugated
1-CSB-PA020463LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS6 Antibody, Biotin conjugated
1-CSB-PA020463LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human RPS6 shRNA Plasmid
20-abx954169
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS6 (pS235 / 236) Antibody
20-abx000347
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti-RPS6 (Ab-235)
LF-PA20438 100 ul
EUR 334
Description: Rabbit polyclonal to RPS6
anti-RPS6 (Phospho-Ser235)
LF-PA20439 100 ul
EUR 354
Description: Rabbit polyclonal to RPS6 (Phospho-Ser235)
RPS6 Recombinant Protein (Human)
RP027205 100 ug Ask for price
RPS6 Recombinant Protein (Human)
RP027208 100 ug Ask for price
RPS6 Recombinant Protein (Human)
RP027211 100 ug Ask for price
RPS6 Recombinant Protein (Mouse)
RP169271 100 ug Ask for price
RPS6 Recombinant Protein (Rat)
RP226865 100 ug Ask for price
Anti-RPS6 (3H1-F2)
YF-MA15259 100 ug
EUR 363
Description: Mouse monoclonal to RPS6
RPS6 (Ab-235/236) Antibody
CSB-PA833207-
EUR 335
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against RPS6 (Ab-235/236). Recognizes RPS6 (Ab-235/236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
RPS6 (Ab-235/236) Antibody
CSB-PA833207-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against RPS6 (Ab-235/236). Recognizes RPS6 (Ab-235/236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
Phospho-RPS6 (Ser235/236) Antibody
CSB-PA070173-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235/236). Recognizes Phospho-RPS6 (Ser235/236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
Phospho-RPS6 (Ser235/236) Antibody
CSB-PA070173-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235/236). Recognizes Phospho-RPS6 (Ser235/236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
Polyclonal RPS6 / S6 Antibody (Ser235)
APR02416G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 / S6 (Ser235). This antibody is tested and proven to work in the following applications:
Polyclonal RPS6 (Ser240/244) Antibody
APR03431G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (Ser240/244) . This antibody is tested and proven to work in the following applications:
Polyclonal RPS6 Antibody (N-term)
APR04470G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal RPS6 Antibody (N-term)
APR04525G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (N-term). This antibody is tested and proven to work in the following applications:
Phospho-RPS6-S235 Rabbit pAb
AP0227-100ul 100 ul
EUR 384
Phospho-RPS6-S235 Rabbit pAb
AP0227-200ul 200 ul
EUR 554
Phospho-RPS6-S235 Rabbit pAb
AP0227-20ul 20 ul Ask for price
Phospho-RPS6-S235 Rabbit pAb
AP0227-50ul 50 ul
EUR 265
Phospho-RPS6 (S235/S236) Antibody
1-CSB-PA040248
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RPS6 (S235/S236). Recognizes Phospho-RPS6 (S235/S236) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
Ribosomal Protein S6 (RPS6) Antibody
abx025662-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
abx025662-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
20-abx004661
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
20-abx115271
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
20-abx121719
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
abx146437-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
20-abx141036
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
abx031204-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S6 (RPS6) Antibody
abx031204-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.