RPS6

RPS6 siRNA
20-abx904713	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS6 antibody
70R-51631	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal RPS6 antibody

rpS6 antibody
70R-34575	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal rpS6 antibody

RPS6 antibody
70R-20015	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPS6 antibody

RPS6 antibody
70R-10315	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RPS6 antibody

RPS6 siRNA
20-abx932110	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS6 siRNA
20-abx932111	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS6 Antibody
1-CSB-PA004005	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

RPS6 Antibody
1-CSB-PA004006	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

RPS6 Antibody
1-CSB-PA040250	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPS6 Antibody
1-CSB-PA020463GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPS6 Antibody
1-CSB-PA020463LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

pOTB7-RPS6
PVT18296	Lifescience Market	2 ug	EUR 231

anti-RPS6
YF-PA24620	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPS6

RPS6 cloning plasmid
CSB-CL020463HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 750 Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca Show more
Description: A cloning plasmid for the RPS6 gene.

RPS6 cloning plasmid
CSB-CL020463HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 750 Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca Show more
Description: A cloning plasmid for the RPS6 gene.

RPS6 cloning plasmid
CSB-CL020463HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 750 Sequence: atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaaca Show more
Description: A cloning plasmid for the RPS6 gene.

anti- RPS6 antibody
FNab07482	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: ribosomal protein S6 Uniprot ID: P62753 Gene ID: 6194 Research Area: Metabolism
Description: Antibody raised against RPS6

RPS6 (pS240) Antibody
20-abx121718	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RPS6 (pS235) Antibody
20-abx000279	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

RPS6 Blocking Peptide
20-abx161429	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

RPS6 (pS235) Antibody
20-abx133808	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RPS6 Blocking Peptide
20-abx061734	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-RPS6 Antibody
A01567-1	BosterBio	100ug/vial	EUR 334

RPS6 Rabbit pAb
A6058-100ul	Abclonal	100 ul	EUR 308

RPS6 Rabbit pAb
A6058-200ul	Abclonal	200 ul	EUR 459

RPS6 Rabbit pAb
A6058-20ul	Abclonal	20 ul	EUR 183

RPS6 Rabbit pAb
A6058-50ul	Abclonal	50 ul	EUR 223

RPS6 Blocking Peptide
33R-4485	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS6 antibody, catalog no. 70R-10315

RPS6 Polyclonal Antibody
30697-100ul	SAB	100ul	EUR 252

RPS6 Polyclonal Antibody
30697-50ul	SAB	50ul	EUR 187

Anti-RPS6 antibody
PAab07482	Lifescience Market	100 ug	EUR 386

Anti-RPS6 antibody
STJ27852	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 40S subunit. The protein belongs to the S6E family of ribosomal proteins. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases. Phosphorylation is induced by a wide range of stimuli, including growth factors, tumor-promoting agents, and mitogens. Dephosphorylation occurs at growth arrest. The protein may contribute to the control of cell growth and proliferation through the selective translation of particular classes of mRNA. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPS6 antibody
STJ140049	St John's Laboratory	200 µg	EUR 219
Description: Goat polyclonal to RPS6. Ribosomal protein S6 is a component of the 40S ribosomal subunit and is therefore involved in regulating translation – ribosome marker. Studies have also shown to be involved in cell proliferation, regulation of cell size and glucose homeostasis. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases.

Anti-RPS6 Antibody
A1995-100	Biovision	100 µl	EUR 374

RPS6 Polyclonal Conjugated Antibody
C30697	SAB	100ul	EUR 397

Rat RPS6 shRNA Plasmid
20-abx985414	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS6 ELISA KIT|Human
EF002636	Lifescience Market	96 Tests	EUR 689

RPS6 (pS235 / 236) Antibody
20-abx123581	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RPS6 (pS240 / 244) Antibody
20-abx123582	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RPS6 (pS235 / 236) Antibody
20-abx000347	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

RPS6 (pS240) Blocking Peptide
20-abx161428	Abbexa	EUR 885.00 EUR 2124.00	1 mg 5 mg
Shipped within 5-10 working days.

RPS6 (pS235) Blocking Peptide
20-abx162174	Abbexa	EUR 314.00 EUR 509.00	1 mg 5 mg
Shipped within 5-10 working days.

Human RPS6 shRNA Plasmid
20-abx954169	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

rpS6 antibody (Ser235+Ser236)
70R-34574	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal rpS6 antibody (Ser235+Ser236)

Mouse RPS6 shRNA Plasmid
20-abx972521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-RPS6 (Ser235) Antibody
CSB-PA178097-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235). Recognizes Phospho-RPS6 (Ser235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-RPS6 (Ser235) Antibody
CSB-PA178097-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-RPS6 (Ser235). Recognizes Phospho-RPS6 (Ser235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-RPS6 (S235) Antibody
1-CSB-PA040247	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RPS6 (S235). Recognizes Phospho-RPS6 (S235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

Phospho-RPS6 (S240) Antibody
1-CSB-PA040249	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RPS6 (S240). Recognizes Phospho-RPS6 (S240) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

RPS6 (Ab-235) Antibody
CSB-PA061819-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against RPS6 (Ab-235). Recognizes RPS6 (Ab-235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

RPS6 (Ab-235) Antibody
CSB-PA061819-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against RPS6 (Ab-235). Recognizes RPS6 (Ab-235) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

RPS6 Antibody, HRP conjugated
1-CSB-PA020463LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPS6 Antibody, FITC conjugated
1-CSB-PA020463LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPS6 Antibody, Biotin conjugated
1-CSB-PA020463LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS6. Recognizes RPS6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-RPS6 (Ab-235)
LF-PA20438	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to RPS6

anti-RPS6 (Phospho-Ser235)
LF-PA20439	Abfrontier	100 ul	EUR 354
Description: Rabbit polyclonal to RPS6 (Phospho-Ser235)

RPS6 Recombinant Protein (Human)
RP027205	ABM	100 ug	Ask for price

RPS6 Recombinant Protein (Human)
RP027208	ABM	100 ug	Ask for price

RPS6 Recombinant Protein (Human)
RP027211	ABM	100 ug	Ask for price

RPS6 Recombinant Protein (Rat)
RP226865	ABM	100 ug	Ask for price

RPS6 Recombinant Protein (Mouse)
RP169271	ABM	100 ug	Ask for price

Anti-RPS6 (3H1-F2)
YF-MA15259	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPS6

Polyclonal RPS6 / S6 Antibody (Ser235)
APR02416G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 / S6 (Ser235). This antibody is tested and proven to work in the following applications:

Phospho-RPS6-S235 Rabbit pAb
AP0227-100ul	Abclonal	100 ul	EUR 384

Phospho-RPS6-S235 Rabbit pAb
AP0227-200ul	Abclonal	200 ul	EUR 554

Phospho-RPS6-S235 Rabbit pAb
AP0227-20ul	Abclonal	20 ul	Ask for price

Phospho-RPS6-S235 Rabbit pAb
AP0227-50ul	Abclonal	50 ul	EUR 265

Polyclonal RPS6 (Ser240/244) Antibody
APR03431G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (Ser240/244) . This antibody is tested and proven to work in the following applications:

Polyclonal RPS6 Antibody (N-term)
APR04470G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal RPS6 Antibody (N-term)
APR04525G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS6 (N-term). This antibody is tested and proven to work in the following applications:

Ribosomal Protein S6 (RPS6) Antibody
20-abx115271	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx121719	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx000902	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx141036	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx146437-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx025662-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx025662-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx004661	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx031204-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx031204-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx031423-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
abx031423-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx326547	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein S6 (RPS6) Antibody
20-abx328093	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.