RPS3A antibody
70R-20012 50 ul
EUR 435
Description: Rabbit polyclonal RPS3A antibody
RPS3A antibody
70R-2444 50 ug
EUR 467
Description: Rabbit polyclonal RPS3A antibody raised against the N terminal of RPS3A
RPS3A antibody
38708-100ul 100ul
EUR 252
RPS3A Antibody
DF9123 200ul
EUR 304
Description: RPS3A Antibody detects endogenous levels of total RPS3A.
RPS3A Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS3A. Recognizes RPS3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS3A Antibody
ABD9123 100 ug
EUR 438
YF-PA24618 50 ul
EUR 334
Description: Mouse polyclonal to RPS3A
RPS3A Blocking Peptide
33R-1414 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS3A antibody, catalog no. 70R-2444
RPS3A Blocking Peptide
DF9123-BP 1mg
EUR 195
RPS3A Conjugated Antibody
C38708 100ul
EUR 397
RPS3A cloning plasmid
CSB-CL020444HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggcggttggcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatc
  • Show more
Description: A cloning plasmid for the RPS3A gene.
RPS3A cloning plasmid
CSB-CL020444HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggcggttagcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatc
  • Show more
Description: A cloning plasmid for the RPS3A gene.
RPS3A Rabbit pAb
A5885-100ul 100 ul
EUR 308
RPS3A Rabbit pAb
A5885-200ul 200 ul
EUR 459
RPS3A Rabbit pAb
A5885-20ul 20 ul
EUR 183
RPS3A Rabbit pAb
A5885-50ul 50 ul
EUR 223
anti- RPS3A antibody
FNab07478 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:100
  • Immunogen: ribosomal protein S3A
  • Uniprot ID: P61247
  • Gene ID: 6189
  • Research Area: Metabolism
Description: Antibody raised against RPS3A
Anti-RPS3A antibody
PAab07478 100 ug
EUR 386
PVT13260 2 ug
EUR 391
Anti-RPS3A antibody
STJ28158 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene.
RPS3A protein (His tag)
80R-2318 100 ug
EUR 322
Description: Purified recombinant Human RPS3A Protein (His tag)
EF002632 96 Tests
EUR 689
Mouse RPS3A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS3A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS3A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS3A Recombinant Protein (Human)
RP027190 100 ug Ask for price
RPS3A Recombinant Protein (Human)
RP027193 100 ug Ask for price
RPS3A Recombinant Protein (Mouse)
RP169262 100 ug Ask for price
RPS3A Recombinant Protein (Rat)
RP226853 100 ug Ask for price
Ribosomal Protein S3A (RPS3A) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S3A (RPS3A) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S3A (RPS3A) Antibody
abx032550-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S3A (RPS3A) Antibody
abx032550-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S3A (RPS3A) Antibody
abx237478-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Rps3a ORF Vector (Rat) (pORF)
ORF075619 1.0 ug DNA
EUR 506
RPS3A ORF Vector (Human) (pORF)
ORF009064 1.0 ug DNA
EUR 95
RPS3A ORF Vector (Human) (pORF)
ORF009065 1.0 ug DNA
EUR 95
Rps3a ORF Vector (Mouse) (pORF)
ORF056422 1.0 ug DNA
EUR 506
[One Step] RPS3A antibody Kit
RK05728 50 ul
EUR 240
Rps3a sgRNA CRISPR Lentivector set (Rat)
K6929201 3 x 1.0 ug
EUR 339
Rps3a sgRNA CRISPR Lentivector set (Mouse)
K4397001 3 x 1.0 ug
EUR 339
RPS3A sgRNA CRISPR Lentivector set (Human)
K2004701 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S3A (RPS3A) ELISA Kit
abx382956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rps3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6929202 1.0 ug DNA
EUR 154
Rps3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6929203 1.0 ug DNA
EUR 154
Rps3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6929204 1.0 ug DNA
EUR 154
Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4397002 1.0 ug DNA
EUR 154
Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4397003 1.0 ug DNA
EUR 154
Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4397004 1.0 ug DNA
EUR 154
RPS3A sgRNA CRISPR Lentivector (Human) (Target 1)
K2004702 1.0 ug DNA
EUR 154
RPS3A sgRNA CRISPR Lentivector (Human) (Target 2)
K2004703 1.0 ug DNA
EUR 154
RPS3A sgRNA CRISPR Lentivector (Human) (Target 3)
K2004704 1.0 ug DNA
EUR 154
RPS3A Ribosomal Protein S3A Human Recombinant Protein
PROTP61247 Regular: 20ug
EUR 317
Description: RPS3A Human Recombinant produced in E. coli is a single polypeptide chain containing 288 amino acids (1-264) and having a molecular mass of 32.5kDa.;RPS3A is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
RPS3A Protein Vector (Rat) (pPB-C-His)
PV302474 500 ng
EUR 603
RPS3A Protein Vector (Rat) (pPB-N-His)
PV302475 500 ng
EUR 603
RPS3A Protein Vector (Rat) (pPM-C-HA)
PV302476 500 ng
EUR 603
RPS3A Protein Vector (Rat) (pPM-C-His)
PV302477 500 ng
EUR 603
RPS3A Protein Vector (Mouse) (pPB-C-His)
PV225686 500 ng
EUR 603
RPS3A Protein Vector (Mouse) (pPB-N-His)
PV225687 500 ng
EUR 603
RPS3A Protein Vector (Mouse) (pPM-C-HA)
PV225688 500 ng
EUR 603
RPS3A Protein Vector (Mouse) (pPM-C-His)
PV225689 500 ng
EUR 603
RPS3A Protein Vector (Human) (pPB-C-His)
PV036253 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPB-N-His)
PV036254 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPM-C-HA)
PV036255 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPM-C-His)
PV036256 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPB-C-His)
PV036257 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPB-N-His)
PV036258 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPM-C-HA)
PV036259 500 ng
EUR 329
RPS3A Protein Vector (Human) (pPM-C-His)
PV036260 500 ng
EUR 329
Recombinant Human RPS3A Protein, His, E.coli-1mg
QP13357-1mg 1mg
EUR 2757
Recombinant Human RPS3A Protein, His, E.coli-20ug
QP13357-20ug 20ug
EUR 201
Recombinant Human RPS3A Protein, His, E.coli-5ug
QP13357-5ug 5ug
EUR 155
Rps3a 3'UTR Luciferase Stable Cell Line
TU118158 1.0 ml Ask for price
Rps3a 3'UTR GFP Stable Cell Line
TU168158 1.0 ml Ask for price
Rps3a 3'UTR Luciferase Stable Cell Line
TU219701 1.0 ml Ask for price
Rps3a 3'UTR GFP Stable Cell Line
TU269701 1.0 ml Ask for price
RPS3A 3'UTR GFP Stable Cell Line
TU071728 1.0 ml
EUR 1394
RPS3A 3'UTR Luciferase Stable Cell Line
TU021728 1.0 ml
EUR 1394
Rabbit 40S ribosomal protein S3a(RPS3A) ELISA kit
E04R0147-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S3a(RPS3A) ELISA kit
E04R0147-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S3a(RPS3A) ELISA kit
E04R0147-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S3a(RPS3A) ELISA kit
E02R0147-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.