RPS3A

RPS3A Antibody
ABD9123	Lifescience Market	100 ug	EUR 438

RPS3A antibody
70R-2444	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RPS3A antibody raised against the N terminal of RPS3A

RPS3A antibody
38708-100ul	SAB	100ul	EUR 252

RPS3A antibody
70R-20012	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPS3A antibody

RPS3A antibody
70R-12869	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RPS3A antibody

RPS3A Antibody
DF9123	Affbiotech	200ul	EUR 304
Description: RPS3A Antibody detects endogenous levels of total RPS3A.

RPS3A siRNA
20-abx932081	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS3A siRNA
20-abx932082	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS3A Antibody
1-CSB-PA020444GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS3A. Recognizes RPS3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-RPS3A
YF-PA24618	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPS3A

RPS3A Conjugated Antibody
C38708	SAB	100ul	EUR 397

RPS3A cloning plasmid
CSB-CL020444HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggcggttggcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatc Show more
Description: A cloning plasmid for the RPS3A gene.

RPS3A cloning plasmid
CSB-CL020444HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggcggttagcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatc Show more
Description: A cloning plasmid for the RPS3A gene.

anti- RPS3A antibody
FNab07478	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 IP: 1:50 - 1:100 Immunogen: ribosomal protein S3A Uniprot ID: P61247 Gene ID: 6189 Research Area: Metabolism
Description: Antibody raised against RPS3A

RPS3A Rabbit pAb
A5885-100ul	Abclonal	100 ul	EUR 308

RPS3A Rabbit pAb
A5885-200ul	Abclonal	200 ul	EUR 459

RPS3A Rabbit pAb
A5885-20ul	Abclonal	20 ul	EUR 183

RPS3A Rabbit pAb
A5885-50ul	Abclonal	50 ul	EUR 223

RPS3A Blocking Peptide
33R-1414	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS3A antibody, catalog no. 70R-2444

RPS3A Blocking Peptide
DF9123-BP	Affbiotech	1mg	EUR 195

Anti-RPS3A antibody
PAab07478	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-RPS3A
PVT13260	Lifescience Market	2 ug	EUR 391

Anti-RPS3A antibody
STJ28158	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene.

Rat RPS3A shRNA Plasmid
20-abx985407	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS3A ELISA KIT|Human
EF002632	Lifescience Market	96 Tests	EUR 689

Human RPS3A shRNA Plasmid
20-abx954165	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS3A protein (His tag)
80R-2318	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human RPS3A Protein (His tag)

Mouse RPS3A shRNA Plasmid
20-abx972518	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS3A Recombinant Protein (Human)
RP027190	ABM	100 ug	Ask for price

RPS3A Recombinant Protein (Human)
RP027193	ABM	100 ug	Ask for price

RPS3A Recombinant Protein (Rat)
RP226853	ABM	100 ug	Ask for price

RPS3A Recombinant Protein (Mouse)
RP169262	ABM	100 ug	Ask for price

Ribosomal Protein S3A (RPS3A) Antibody
20-abx142204	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein S3A (RPS3A) Antibody
abx032550-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein S3A (RPS3A) Antibody
abx032550-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein S3A (RPS3A) Antibody
20-abx004514	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein S3A (RPS3A) Antibody
abx237478-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RPS3A ORF Vector (Human) (pORF)
ORF009064	ABM	1.0 ug DNA	EUR 95

RPS3A ORF Vector (Human) (pORF)
ORF009065	ABM	1.0 ug DNA	EUR 95

Rps3a ORF Vector (Mouse) (pORF)
ORF056422	ABM	1.0 ug DNA	EUR 506

Rps3a ORF Vector (Rat) (pORF)
ORF075619	ABM	1.0 ug DNA	EUR 506

[One Step] RPS3A antibody Kit
RK05728	Abclonal	50 ul	EUR 240

RPS3A sgRNA CRISPR Lentivector set (Human)
K2004701	ABM	3 x 1.0 ug	EUR 339

Rps3a sgRNA CRISPR Lentivector set (Mouse)
K4397001	ABM	3 x 1.0 ug	EUR 339

Rps3a sgRNA CRISPR Lentivector set (Rat)
K6929201	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein S3A (RPS3A) ELISA Kit
abx382956-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RPS3A sgRNA CRISPR Lentivector (Human) (Target 1)
K2004702	ABM	1.0 ug DNA	EUR 154

RPS3A sgRNA CRISPR Lentivector (Human) (Target 2)
K2004703	ABM	1.0 ug DNA	EUR 154

RPS3A sgRNA CRISPR Lentivector (Human) (Target 3)
K2004704	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4397002	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4397003	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4397004	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6929202	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6929203	ABM	1.0 ug DNA	EUR 154

Rps3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6929204	ABM	1.0 ug DNA	EUR 154

RPS3A Protein Vector (Human) (pPB-C-His)
PV036253	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPB-N-His)
PV036254	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPM-C-HA)
PV036255	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPM-C-His)
PV036256	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPB-C-His)
PV036257	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPB-N-His)
PV036258	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPM-C-HA)
PV036259	ABM	500 ng	EUR 329

RPS3A Protein Vector (Human) (pPM-C-His)
PV036260	ABM	500 ng	EUR 329

Recombinant Human RPS3A Protein, His, E.coli-1mg
QP13357-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RPS3A Protein, His, E.coli-20ug
QP13357-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RPS3A Protein, His, E.coli-5ug
QP13357-5ug	EnQuireBio	5ug	EUR 155

RPS3A Ribosomal Protein S3A Human Recombinant Protein
PROTP61247	BosterBio	Regular: 20ug	EUR 317
Description: RPS3A Human Recombinant produced in E. coli is a single polypeptide chain containing 288 amino acids (1-264) and having a molecular mass of 32.5kDa.;RPS3A is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPS3A Protein Vector (Rat) (pPB-C-His)
PV302474	ABM	500 ng	EUR 603

RPS3A Protein Vector (Rat) (pPB-N-His)
PV302475	ABM	500 ng	EUR 603

RPS3A Protein Vector (Rat) (pPM-C-HA)
PV302476	ABM	500 ng	EUR 603

RPS3A Protein Vector (Rat) (pPM-C-His)
PV302477	ABM	500 ng	EUR 603

RPS3A Protein Vector (Mouse) (pPB-C-His)
PV225686	ABM	500 ng	EUR 603

RPS3A Protein Vector (Mouse) (pPB-N-His)
PV225687	ABM	500 ng	EUR 603

RPS3A Protein Vector (Mouse) (pPM-C-HA)
PV225688	ABM	500 ng	EUR 603

RPS3A Protein Vector (Mouse) (pPM-C-His)
PV225689	ABM	500 ng	EUR 603

Rps3a 3'UTR GFP Stable Cell Line
TU168158	ABM	1.0 ml	Ask for price

RPS3A 3'UTR Luciferase Stable Cell Line
TU021728	ABM	1.0 ml	EUR 1394

Rps3a 3'UTR Luciferase Stable Cell Line
TU118158	ABM	1.0 ml	Ask for price

RPS3A 3'UTR GFP Stable Cell Line
TU071728	ABM	1.0 ml	EUR 1394

Rps3a 3'UTR Luciferase Stable Cell Line
TU219701	ABM	1.0 ml	Ask for price

Rps3a 3'UTR GFP Stable Cell Line
TU269701	ABM	1.0 ml	Ask for price

Rat 40S ribosomal protein S3a(RPS3A) ELISA kit
E02R0147-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S3a(RPS3A) ELISA kit
E02R0147-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S3a(RPS3A) ELISA kit
E02R0147-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S3a(RPS3A) ELISA kit
E03R0147-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S3a(RPS3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.