  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS26 antibody
70R-20006 50 ul
EUR 435
Description: Rabbit polyclonal RPS26 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS26 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
RPS26 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
RPS26 cloning plasmid
CSB-CL020407HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 348
  • Sequence: atgacaaagaaaagaaggaacaatggtcgtgccaaaaagggccgcggccacgtgcagcctattcgctgcactaactgtgcccgatgcgtgcccaaggacaaggccattaagaaattcgtcattcgaaacatagtggaggccgcagcagtcagggacatttctgaagcgagcgtctt
  • Show more
Description: A cloning plasmid for the RPS26 gene.
anti- RPS26 antibody
FNab07469 100µg
EUR 548.75
  • Immunogen: ribosomal protein S26
  • Uniprot ID: P62854
  • Gene ID: 6231
  • Research Area: Metabolism
Description: Antibody raised against RPS26
RPS26 Polyclonal Antibody
A63354 100 µg
EUR 570.55
Description: fast delivery possible
RPS26 Rabbit pAb
A15096-100ul 100 ul
EUR 308
RPS26 Rabbit pAb
A15096-200ul 200 ul
EUR 459
RPS26 Rabbit pAb
A15096-20ul 20 ul
EUR 183
RPS26 Rabbit pAb
A15096-50ul 50 ul
EUR 223
RPS26 Polyclonal Antibody
28829-100ul 100ul
EUR 252
RPS26 Polyclonal Antibody
28829-50ul 50ul
EUR 187
Anti-RPS26 antibody
PAab07469 100 ug
EUR 386
Anti-RPS26 antibody
STJ117290 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S26E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
RPS26 Polyclonal Conjugated Antibody
C28829 100ul
EUR 397
Mouse RPS26 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS26 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF002625 96 Tests
EUR 689
Human RPS26 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS26 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS26 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS26 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RPS26 Recombinant Protein (Human)
RP027163 100 ug Ask for price
RPS26 Recombinant Protein (Rat)
RP226835 100 ug Ask for price
RPS26 Recombinant Protein (Mouse)
RP169238 100 ug Ask for price
Ribosomal Protein S26 (RPS26) Antibody
abx146457-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S26 (RPS26) Antibody
abx032460-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S26 (RPS26) Antibody
abx032460-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S26 (RPS26) Antibody
abx237469-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S26 (RPS26) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS26 Polyclonal Antibody, HRP Conjugated
A63355 100 µg
EUR 570.55
Description: reagents widely cited
RPS26 Polyclonal Antibody, FITC Conjugated
A63356 100 µg
EUR 570.55
Description: Ask the seller for details
RPS26 Polyclonal Antibody, Biotin Conjugated
A63357 100 µg
EUR 570.55
Description: The best epigenetics products
RPS26 ORF Vector (Human) (pORF)
ORF009055 1.0 ug DNA
EUR 95
Rps26 ORF Vector (Mouse) (pORF)
ORF056414 1.0 ug DNA
EUR 506
Rps26 ORF Vector (Rat) (pORF)
ORF075613 1.0 ug DNA
EUR 506
Ribosomal Protein S26 (RPS26) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S26 (RPS26) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S26 (RPS26) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS26 sgRNA CRISPR Lentivector set (Human)
K2048201 3 x 1.0 ug
EUR 339
Rps26 sgRNA CRISPR Lentivector set (Mouse)
K4650701 3 x 1.0 ug
EUR 339
Rps26 sgRNA CRISPR Lentivector set (Rat)
K6830301 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S26 (RPS26) ELISA Kit
abx382950-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
RPS26 sgRNA CRISPR Lentivector (Human) (Target 1)
K2048202 1.0 ug DNA
EUR 154
RPS26 sgRNA CRISPR Lentivector (Human) (Target 2)
K2048203 1.0 ug DNA
EUR 154
RPS26 sgRNA CRISPR Lentivector (Human) (Target 3)
K2048204 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4650702 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4650703 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4650704 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6830302 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6830303 1.0 ug DNA
EUR 154
Rps26 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6830304 1.0 ug DNA
EUR 154
RPS26 Protein Vector (Human) (pPB-C-His)
PV036217 500 ng
EUR 329
RPS26 Protein Vector (Human) (pPB-N-His)
PV036218 500 ng
EUR 329
RPS26 Protein Vector (Human) (pPM-C-HA)
PV036219 500 ng
EUR 329
RPS26 Protein Vector (Human) (pPM-C-His)
PV036220 500 ng
EUR 329
RPS26 Protein Vector (Rat) (pPB-C-His)
PV302450 500 ng
EUR 603
RPS26 Protein Vector (Rat) (pPB-N-His)
PV302451 500 ng
EUR 603
RPS26 Protein Vector (Rat) (pPM-C-HA)
PV302452 500 ng
EUR 603
RPS26 Protein Vector (Rat) (pPM-C-His)
PV302453 500 ng
EUR 603
RPS26 Protein Vector (Mouse) (pPB-C-His)
PV225654 500 ng
EUR 603
RPS26 Protein Vector (Mouse) (pPB-N-His)
PV225655 500 ng
EUR 603
RPS26 Protein Vector (Mouse) (pPM-C-HA)
PV225656 500 ng
EUR 603
RPS26 Protein Vector (Mouse) (pPM-C-His)
PV225657 500 ng
EUR 603
Rps26 3'UTR GFP Stable Cell Line
TU168151 1.0 ml Ask for price
RPS26 3'UTR Luciferase Stable Cell Line
TU022163 1.0 ml
EUR 1394
Rps26 3'UTR Luciferase Stable Cell Line
TU118151 1.0 ml Ask for price
RPS26 3'UTR GFP Stable Cell Line
TU072163 1.0 ml
EUR 1394
Rps26 3'UTR Luciferase Stable Cell Line
TU219694 1.0 ml Ask for price
Rps26 3'UTR GFP Stable Cell Line
TU269694 1.0 ml Ask for price
Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.