RPS26

RPS26 antibody
70R-20006	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPS26 antibody

RPS26 Antibody
1-CSB-PA020407GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

RPS26 Antibody
1-CSB-PA020407LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPS26 siRNA
20-abx904701	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS26 siRNA
20-abx932067	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS26 siRNA
20-abx932068	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS26 Polyclonal Antibody
28829-100ul	SAB	100ul	EUR 252

RPS26 Polyclonal Antibody
28829-50ul	SAB	50ul	EUR 187

RPS26 cloning plasmid
CSB-CL020407HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 348 Sequence: atgacaaagaaaagaaggaacaatggtcgtgccaaaaagggccgcggccacgtgcagcctattcgctgcactaactgtgcccgatgcgtgcccaaggacaaggccattaagaaattcgtcattcgaaacatagtggaggccgcagcagtcagggacatttctgaagcgagcgtctt Show more
Description: A cloning plasmid for the RPS26 gene.

RPS26 Polyclonal Antibody
A63354	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPS26 Rabbit pAb
A15096-100ul	Abclonal	100 ul	EUR 308

RPS26 Rabbit pAb
A15096-200ul	Abclonal	200 ul	EUR 459

RPS26 Rabbit pAb
A15096-20ul	Abclonal	20 ul	EUR 183

RPS26 Rabbit pAb
A15096-50ul	Abclonal	50 ul	EUR 223

anti- RPS26 antibody
FNab07469	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein S26 Uniprot ID: P62854 Gene ID: 6231 Research Area: Metabolism
Description: Antibody raised against RPS26

Anti-RPS26 antibody
PAab07469	Lifescience Market	100 ug	EUR 386

Anti-RPS26 antibody
STJ117290	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S26E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

RPS26 ELISA KIT|Human
EF002625	Lifescience Market	96 Tests	EUR 689

Mouse RPS26 shRNA Plasmid
20-abx973879	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPS26 shRNA Plasmid
20-abx985297	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS26 Polyclonal Conjugated Antibody
C28829	SAB	100ul	EUR 397

RPS26 Antibody, HRP conjugated
1-CSB-PA020407LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPS26 Antibody, FITC conjugated
1-CSB-PA020407LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPS26 Antibody, Biotin conjugated
1-CSB-PA020407LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS26. Recognizes RPS26 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPS26 shRNA Plasmid
20-abx954194	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPS26 Recombinant Protein (Human)
RP027163	ABM	100 ug	Ask for price

RPS26 Recombinant Protein (Mouse)
RP169238	ABM	100 ug	Ask for price

RPS26 Recombinant Protein (Rat)
RP226835	ABM	100 ug	Ask for price

Ribosomal Protein S26 (RPS26) Antibody
abx146457-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ribosomal Protein S26 (RPS26) Antibody
abx032460-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein S26 (RPS26) Antibody
abx032460-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein S26 (RPS26) Antibody
abx237469-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein S26 (RPS26) Antibody
20-abx301269	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPS26 Polyclonal Antibody, HRP Conjugated
A63355	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RPS26 Polyclonal Antibody, FITC Conjugated
A63356	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPS26 Polyclonal Antibody, Biotin Conjugated
A63357	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Rps26 ORF Vector (Rat) (pORF)
ORF075613	ABM	1.0 ug DNA	EUR 506

RPS26 ORF Vector (Human) (pORF)
ORF009055	ABM	1.0 ug DNA	EUR 95

Rps26 ORF Vector (Mouse) (pORF)
ORF056414	ABM	1.0 ug DNA	EUR 506

Ribosomal Protein S26 (RPS26) Antibody (HRP)
20-abx305183	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein S26 (RPS26) Antibody (FITC)
20-abx305184	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein S26 (RPS26) Antibody (Biotin)
20-abx305185	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rps26 sgRNA CRISPR Lentivector set (Mouse)
K4650701	ABM	3 x 1.0 ug	EUR 339

Rps26 sgRNA CRISPR Lentivector set (Rat)
K6830301	ABM	3 x 1.0 ug	EUR 339

RPS26 sgRNA CRISPR Lentivector set (Human)
K2048201	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein S26 (RPS26) ELISA Kit
abx382950-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4650702	ABM	1.0 ug DNA	EUR 154

Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4650703	ABM	1.0 ug DNA	EUR 154

Rps26 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4650704	ABM	1.0 ug DNA	EUR 154

Rps26 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6830302	ABM	1.0 ug DNA	EUR 154

Rps26 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6830303	ABM	1.0 ug DNA	EUR 154

Rps26 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6830304	ABM	1.0 ug DNA	EUR 154

RPS26 sgRNA CRISPR Lentivector (Human) (Target 1)
K2048202	ABM	1.0 ug DNA	EUR 154

RPS26 sgRNA CRISPR Lentivector (Human) (Target 2)
K2048203	ABM	1.0 ug DNA	EUR 154

RPS26 sgRNA CRISPR Lentivector (Human) (Target 3)
K2048204	ABM	1.0 ug DNA	EUR 154

RPS26 Protein Vector (Rat) (pPB-C-His)
PV302450	ABM	500 ng	EUR 603

RPS26 Protein Vector (Rat) (pPB-N-His)
PV302451	ABM	500 ng	EUR 603

RPS26 Protein Vector (Rat) (pPM-C-HA)
PV302452	ABM	500 ng	EUR 603

RPS26 Protein Vector (Rat) (pPM-C-His)
PV302453	ABM	500 ng	EUR 603

RPS26 Protein Vector (Mouse) (pPB-C-His)
PV225654	ABM	500 ng	EUR 603

RPS26 Protein Vector (Mouse) (pPB-N-His)
PV225655	ABM	500 ng	EUR 603

RPS26 Protein Vector (Mouse) (pPM-C-HA)
PV225656	ABM	500 ng	EUR 603

RPS26 Protein Vector (Mouse) (pPM-C-His)
PV225657	ABM	500 ng	EUR 603

RPS26 Protein Vector (Human) (pPB-C-His)
PV036217	ABM	500 ng	EUR 329

RPS26 Protein Vector (Human) (pPB-N-His)
PV036218	ABM	500 ng	EUR 329

RPS26 Protein Vector (Human) (pPM-C-HA)
PV036219	ABM	500 ng	EUR 329

RPS26 Protein Vector (Human) (pPM-C-His)
PV036220	ABM	500 ng	EUR 329

Rps26 3'UTR Luciferase Stable Cell Line
TU118151	ABM	1.0 ml	Ask for price

Rps26 3'UTR GFP Stable Cell Line
TU168151	ABM	1.0 ml	Ask for price

Rps26 3'UTR Luciferase Stable Cell Line
TU219694	ABM	1.0 ml	Ask for price

Rps26 3'UTR GFP Stable Cell Line
TU269694	ABM	1.0 ml	Ask for price

RPS26 3'UTR GFP Stable Cell Line
TU072163	ABM	1.0 ml	EUR 1394

RPS26 3'UTR Luciferase Stable Cell Line
TU022163	ABM	1.0 ml	EUR 1394

Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S26(RPS26) ELISA kit
E04R0140-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S26(RPS26) ELISA kit
E02R0140-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S26(RPS26) ELISA kit
E03R0140-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S26(RPS26) ELISA kit
E01R0140-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S26(RPS26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.