RPS14 antibody
70R-20000 50 ul
EUR 435
Description: Rabbit polyclonal RPS14 antibody
RPS14 antibody
70R-1391 100 ug
EUR 377
Description: Rabbit polyclonal RPS14 antibody raised against the middle region of RPS14
RPS14 antibody
70R-1393 100 ug
EUR 377
Description: Rabbit polyclonal RPS14 antibody raised against the N terminal of RPS14
RPS14 antibody
70R-15340 100 ug
EUR 327
Description: Rabbit polyclonal RPS14 antibody
RPS14 antibody
39134-100ul 100ul
EUR 252
RPS14 Antibody
DF12468 200ul
EUR 304
Description: RPS14 antibody detects endogenous levels of RPS14.
RPS14 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS14. Recognizes RPS14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
RPS14 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS14. Recognizes RPS14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA24626 50 ul
EUR 334
Description: Mouse polyclonal to RPS14
YF-PA24627 50 ul
EUR 334
Description: Mouse polyclonal to RPS14
RPS14 Blocking Peptide
33R-3457 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS14 antibody, catalog no. 70R-1391
RPS14 Blocking Peptide
33R-1437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS14 antibody, catalog no. 70R-1393
RPS14 antibody (HRP)
60R-1847 100 ug
EUR 327
Description: Rabbit polyclonal RPS14 antibody (HRP)
RPS14 antibody (FITC)
60R-1848 100 ug
EUR 327
Description: Rabbit polyclonal RPS14 antibody (FITC)
RPS14 antibody (biotin)
60R-1849 100 ug
EUR 327
Description: Rabbit polyclonal RPS14 antibody (biotin)
RPS14 Blocking Peptide
DF12468-BP 1mg
EUR 195
RPS14 Conjugated Antibody
C39134 100ul
EUR 397
RPS14 cloning plasmid
CSB-CL020371HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atggcacctcgaaaggggaaggaaaagaaggaagaacaggtcatcagcctcggacctcaggtggctgaaggagagaatgtatttggtgtctgccatatctttgcatccttcaatgacacttttgtccatgtcactgatctttctggcaaggaaaccatctgccgtgtgactggtgg
  • Show more
Description: A cloning plasmid for the RPS14 gene.
RPS14 cloning plasmid
CSB-CL020371HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atggcacctcgaaaggggaaggaaaagaaggaagaacaggtcatcagcctcggacctcaggtggctgaaggagagaatgtatttggtgtctgccatatctttgcatccttcaatgacacttttgtccatgtcactgatctttctggcaaagaaaccatctgccgtgtgactggtgg
  • Show more
Description: A cloning plasmid for the RPS14 gene.
RPS14 Rabbit pAb
A4094-100ul 100 ul
EUR 308
RPS14 Rabbit pAb
A4094-200ul 200 ul
EUR 459
RPS14 Rabbit pAb
A4094-20ul 20 ul Ask for price
RPS14 Rabbit pAb
A4094-50ul 50 ul Ask for price
RPS14 Rabbit pAb
A6727-100ul 100 ul
EUR 308
RPS14 Rabbit pAb
A6727-200ul 200 ul
EUR 459
RPS14 Rabbit pAb
A6727-20ul 20 ul
EUR 183
RPS14 Rabbit pAb
A6727-50ul 50 ul
EUR 223
RPS14 Polyclonal Antibody
A51781 100 µg
EUR 570.55
Description: Ask the seller for details
anti- RPS14 antibody
FNab07460 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ribosomal protein S14
  • Uniprot ID: P62263
  • Gene ID: 6208
  • Research Area: Metabolism
Description: Antibody raised against RPS14
Anti-RPS14 antibody
PAab07460 100 ug
EUR 386
PVT12512 2 ug
EUR 391
PVT17934 2 ug
EUR 231
Anti-RPS14 antibody
STJ25400 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S11P family of ribosomal proteins. It is located in the cytoplasm. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. In Chinese hamster ovary cells, mutations in this gene can lead to resistance to emetine, a protein synthesis inhibitor. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-RPS14 antibody
STJ28810 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S11P family of ribosomal proteins. It is located in the cytoplasm. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. In Chinese hamster ovary cells, mutations in this gene can lead to resistance to emetine, a protein synthesis inhibitor. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-RPS14 (1B3)
YF-MA15270 100 ug
EUR 363
Description: Mouse monoclonal to RPS14
Anti-RPS14 (2B1)
YF-MA15271 100 ug
EUR 363
Description: Mouse monoclonal to RPS14
Anti-RPS14 (3G5)
YF-MA15272 100 ug
EUR 363
Description: Mouse monoclonal to RPS14
Anti-RPS14 (1E8)
YF-MA15273 100 ug
EUR 363
Description: Mouse monoclonal to RPS14
RPS14 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS14. Recognizes RPS14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS14 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS14. Recognizes RPS14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS14 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS14. Recognizes RPS14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RPS14 protein (His tag)
80R-1683 10 ug
EUR 305
Description: Purified recombinant Human RPS14 protein
Mouse RPS14 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS14 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS14 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS14 Recombinant Protein (Human)
RP027103 100 ug Ask for price
RPS14 Recombinant Protein (Human)
RP027106 100 ug Ask for price
RPS14 Recombinant Protein (Mouse)
RP169190 100 ug Ask for price
RPS14 Recombinant Protein (Rat)
RP226793 100 ug Ask for price
Ribosomal Protein S14 (RPS14) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
abx122439-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
abx028554-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
abx028554-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S14 (RPS14) Antibody
abx237460-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
RPS14 Polyclonal Antibody, HRP Conjugated
A51782 100 µg
EUR 570.55
Description: The best epigenetics products
RPS14 Polyclonal Antibody, FITC Conjugated
A51783 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS14 Polyclonal Antibody, Biotin Conjugated
A51784 100 µg
EUR 570.55
Description: fast delivery possible
Rps14 ORF Vector (Rat) (pORF)
ORF075599 1.0 ug DNA
EUR 506
RPS14 ORF Vector (Human) (pORF)
ORF009035 1.0 ug DNA
EUR 95
RPS14 ORF Vector (Human) (pORF)
ORF009036 1.0 ug DNA
EUR 95
Rps14 ORF Vector (Mouse) (pORF)
ORF056398 1.0 ug DNA
EUR 506
[One Step] RPS14 Antibody Kit
RK05702 50 ul
EUR 240
RPS14 ELISA Kit (Rat) (OKEH05985)
OKEH05985 96 Wells
EUR 727
Description: Description of target: structural component of the 40S subunit of the ribosome, the organelle responsible for protein synthesis [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL
RPS14 ELISA Kit (Human) (OKEH06343)
OKEH06343 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.175 ng/mL
RPS14 ELISA Kit (Mouse) (OKEH03549)
OKEH03549 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL
Human 40S ribosomal protein S14 (RPS14)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S14(RPS14),partial expressed in E.coli
Ribosomal Protein S14 (RPS14) Antibody Pair
abx117397-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.
40S Ribosomal Protein S14 (RPS14) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps14 sgRNA CRISPR Lentivector set (Mouse)
K4875801 3 x 1.0 ug
EUR 339
Rps14 sgRNA CRISPR Lentivector set (Rat)
K6787801 3 x 1.0 ug
EUR 339
RPS14 sgRNA CRISPR Lentivector set (Human)
K2028501 3 x 1.0 ug
EUR 339
Mouse Ribosomal Protein S14 (RPS14) ELISA Kit
abx255133-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Rat Ribosomal Protein S14 (RPS14) ELISA Kit
abx520478-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rps14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4875802 1.0 ug DNA
EUR 154
Rps14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4875803 1.0 ug DNA
EUR 154
Rps14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4875804 1.0 ug DNA
EUR 154
Rps14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6787802 1.0 ug DNA
EUR 154
Rps14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6787803 1.0 ug DNA
EUR 154
Rps14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6787804 1.0 ug DNA
EUR 154
RPS14 sgRNA CRISPR Lentivector (Human) (Target 1)
K2028502 1.0 ug DNA
EUR 154