RPN2

RPN2 siRNA

20-abx904682
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPN2 antibody

70R-19994 50 ul
EUR 435
Description: Rabbit polyclonal RPN2 antibody

RPN2 siRNA

20-abx932009
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPN2 siRNA

20-abx932010
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPN2 Antibody

1-CSB-PA020345ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPN2. Recognizes RPN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPN2 Antibody

1-CSB-PA020345GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPN2. Recognizes RPN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

anti-RPN2

YF-PA14447 50 ug
EUR 363
Description: Mouse polyclonal to RPN2

anti-RPN2

YF-PA14448 100 ug
EUR 403
Description: Rabbit polyclonal to RPN2

anti-RPN2

YF-PA24616 50 ul
EUR 334
Description: Mouse polyclonal to RPN2

RPN2 cloning plasmid

CSB-CL020345HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atggcgccgccgggttcaagcactgtcttcctgttggccctgacaatcatagccagcacctgggctctgacgcccactcactacctcaccaagcatgacgtggagagactaaaagcctcgctggatcgccctttcacaaatttggaatctgccttctactccatcgtgggactca
  • Show more
Description: A cloning plasmid for the RPN2 gene.

anti- RPN2 antibody

FNab07451 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ribophorin II
  • Uniprot ID: P04844
  • Gene ID: 6185
  • Research Area: Metabolism
Description: Antibody raised against RPN2

RPN2 Rabbit pAb

A8352-100ul 100 ul
EUR 308

RPN2 Rabbit pAb

A8352-200ul 200 ul
EUR 459

RPN2 Rabbit pAb

A8352-20ul 20 ul
EUR 183

RPN2 Rabbit pAb

A8352-50ul 50 ul
EUR 223

RPN2 Polyclonal Antibody

31519-100ul 100ul
EUR 252

RPN2 Polyclonal Antibody

31519-50ul 50ul
EUR 187

Anti-RPN2 antibody

PAab07451 100 ug
EUR 386

pDONR223-RPN2 Plasmid

PVTB01118-1 2 ug
EUR 356

Anti-RPN2 antibody

STJ110650 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

RPN2 Polyclonal Conjugated Antibody

C31519 100ul
EUR 397

Rat RPN2 shRNA Plasmid

20-abx986340
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken RPN2 ELISA KIT

ELI-14359c 96 Tests
EUR 928

Human RPN2 ELISA KIT

ELI-18587h 96 Tests
EUR 824

RPN2 ELISA KIT|Human

EF002609 96 Tests
EUR 689

Bovine RPN2 ELISA KIT

ELI-53172b 96 Tests
EUR 928

Mouse Rpn2 ELISA KIT

ELI-42199m 96 Tests
EUR 865

Ribophorin 2 (RPN2) Antibody

20-abx115219
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

20-abx142066
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

abx031592-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

abx031592-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human RPN2 shRNA Plasmid

20-abx954162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPN2 protein (His tag)

30R-2964 100 ug
EUR 424
Description: Purified recombinant Human RPN2 protein (His tag)

Mouse RPN2 shRNA Plasmid

20-abx972503
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPN2 Recombinant Protein (Human)

RP027058 100 ug Ask for price

RPN2 Recombinant Protein (Rat)

RP226745 100 ug Ask for price

RPN2 Recombinant Protein (Mouse)

RP169142 100 ug Ask for price

RPN2 ORF Vector (Human) (pORF)

ORF009020 1.0 ug DNA
EUR 95

Rpn2 ORF Vector (Mouse) (pORF)

ORF056382 1.0 ug DNA
EUR 506

Rpn2 ORF Vector (Rat) (pORF)

ORF075583 1.0 ug DNA
EUR 506

RPN2 sgRNA CRISPR Lentivector set (Human)

K1997701 3 x 1.0 ug
EUR 339

Rpn2 sgRNA CRISPR Lentivector set (Rat)

K7093501 3 x 1.0 ug
EUR 339

Rpn2 sgRNA CRISPR Lentivector set (Mouse)

K4887501 3 x 1.0 ug
EUR 339

RPN2 Ribophorin II Human Recombinant Protein

PROTP04844 Regular: 20ug
EUR 317
Description: RPN2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 539 amino acids (23-540) and having a molecular mass of 59.2kDa.;RPN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Ribophorin II(RPN2)ELISA Kit

QY-E03153 96T
EUR 361

Rpn2 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

EF019271 96 Tests
EUR 689

Rpn2 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

EF016100 96 Tests
EUR 689

RPN2 ELISA Kit| Bovine Dolichyl-diphosphooligosaccharide--prote

EF011860 96 Tests
EUR 689

RPN2 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

EF012496 96 Tests
EUR 689

RPN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1997702 1.0 ug DNA
EUR 154

RPN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1997703 1.0 ug DNA
EUR 154

RPN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1997704 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7093502 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7093503 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7093504 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4887502 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4887503 1.0 ug DNA
EUR 154

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4887504 1.0 ug DNA
EUR 154

RPN2 Protein Vector (Human) (pPB-C-His)

PV036077 500 ng
EUR 329

RPN2 Protein Vector (Human) (pPB-N-His)

PV036078 500 ng
EUR 329

RPN2 Protein Vector (Human) (pPM-C-HA)

PV036079 500 ng
EUR 329

RPN2 Protein Vector (Human) (pPM-C-His)

PV036080 500 ng
EUR 329

Recombinant Human RPN2 Protein, His, E.coli-1mg

QP13349-1mg 1mg
EUR 3655

Recombinant Human RPN2 Protein, His, E.coli-20ug

QP13349-20ug 20ug
EUR 201

Recombinant Human RPN2 Protein, His, E.coli-5ug

QP13349-5ug 5ug
EUR 155

RPN2 Protein Vector (Rat) (pPB-C-His)

PV302330 500 ng
EUR 603

RPN2 Protein Vector (Rat) (pPB-N-His)

PV302331 500 ng
EUR 603

RPN2 Protein Vector (Rat) (pPM-C-HA)

PV302332 500 ng
EUR 603

RPN2 Protein Vector (Rat) (pPM-C-His)

PV302333 500 ng
EUR 603

RPN2 Protein Vector (Mouse) (pPB-C-His)

PV225526 500 ng
EUR 603

RPN2 Protein Vector (Mouse) (pPB-N-His)

PV225527 500 ng
EUR 603

RPN2 Protein Vector (Mouse) (pPM-C-HA)

PV225528 500 ng
EUR 603

RPN2 Protein Vector (Mouse) (pPM-C-His)

PV225529 500 ng
EUR 603

Rpn2 3'UTR GFP Stable Cell Line

TU168122 1.0 ml Ask for price

RPN2 3'UTR Luciferase Stable Cell Line

TU021658 1.0 ml
EUR 1394

Rpn2 3'UTR Luciferase Stable Cell Line

TU118122 1.0 ml Ask for price

RPN2 3'UTR GFP Stable Cell Line

TU071658 1.0 ml
EUR 1394

Rpn2 3'UTR Luciferase Stable Cell Line

TU219664 1.0 ml Ask for price

Rpn2 3'UTR GFP Stable Cell Line

TU269664 1.0 ml Ask for price

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody

abx145853-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody

20-abx006133
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody

20-abx321910
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody

abx237451-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV694999 1.0 ug DNA
EUR 682

RPN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695003 1.0 ug DNA
EUR 682