RPN2

RPN2 antibody
70R-19994	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPN2 antibody

RPN2 Antibody
1-CSB-PA020345ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPN2. Recognizes RPN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPN2 Antibody
1-CSB-PA020345GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPN2. Recognizes RPN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

RPN2 siRNA
20-abx904682	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPN2 siRNA
20-abx932009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPN2 siRNA
20-abx932010	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RPN2
YF-PA14447	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RPN2

anti-RPN2
YF-PA14448	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RPN2

anti-RPN2
YF-PA24616	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPN2

RPN2 Polyclonal Antibody
31519-100ul	SAB	100ul	EUR 252

RPN2 Polyclonal Antibody
31519-50ul	SAB	50ul	EUR 187

RPN2 cloning plasmid
CSB-CL020345HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1896 Sequence: atggcgccgccgggttcaagcactgtcttcctgttggccctgacaatcatagccagcacctgggctctgacgcccactcactacctcaccaagcatgacgtggagagactaaaagcctcgctggatcgccctttcacaaatttggaatctgccttctactccatcgtgggactca Show more
Description: A cloning plasmid for the RPN2 gene.

RPN2 Rabbit pAb
A8352-100ul	Abclonal	100 ul	EUR 308

RPN2 Rabbit pAb
A8352-200ul	Abclonal	200 ul	EUR 459

RPN2 Rabbit pAb
A8352-20ul	Abclonal	20 ul	EUR 183

RPN2 Rabbit pAb
A8352-50ul	Abclonal	50 ul	EUR 223

anti- RPN2 antibody
FNab07451	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: ribophorin II Uniprot ID: P04844 Gene ID: 6185 Research Area: Metabolism
Description: Antibody raised against RPN2

Anti-RPN2 antibody
PAab07451	Lifescience Market	100 ug	EUR 386

pDONR223-RPN2 Plasmid
PVTB01118-1	Lifescience Market	2 ug	EUR 356

Anti-RPN2 antibody
STJ110650	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

RPN2 protein (His tag)
30R-2964	Fitzgerald	100 ug	EUR 424
Description: Purified recombinant Human RPN2 protein (His tag)

Ribophorin 2 (RPN2) Antibody
20-abx115219	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
20-abx142066	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
abx031592-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
abx031592-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Chicken RPN2 ELISA KIT
ELI-14359c	Lifescience Market	96 Tests	EUR 928

Human RPN2 ELISA KIT
ELI-18587h	Lifescience Market	96 Tests	EUR 824

RPN2 ELISA KIT|Human
EF002609	Lifescience Market	96 Tests	EUR 689

Bovine RPN2 ELISA KIT
ELI-53172b	Lifescience Market	96 Tests	EUR 928

Mouse Rpn2 ELISA KIT
ELI-42199m	Lifescience Market	96 Tests	EUR 865

Mouse RPN2 shRNA Plasmid
20-abx972503	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPN2 shRNA Plasmid
20-abx986340	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPN2 Polyclonal Conjugated Antibody
C31519	SAB	100ul	EUR 397

Human RPN2 shRNA Plasmid
20-abx954162	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPN2 Recombinant Protein (Human)
RP027058	ABM	100 ug	Ask for price

RPN2 Recombinant Protein (Mouse)
RP169142	ABM	100 ug	Ask for price

RPN2 Recombinant Protein (Rat)
RP226745	ABM	100 ug	Ask for price

Rpn2 ORF Vector (Rat) (pORF)
ORF075583	ABM	1.0 ug DNA	EUR 506

RPN2 ORF Vector (Human) (pORF)
ORF009020	ABM	1.0 ug DNA	EUR 95

Rpn2 ORF Vector (Mouse) (pORF)
ORF056382	ABM	1.0 ug DNA	EUR 506

Rpn2 sgRNA CRISPR Lentivector set (Mouse)
K4887501	ABM	3 x 1.0 ug	EUR 339

Rpn2 sgRNA CRISPR Lentivector set (Rat)
K7093501	ABM	3 x 1.0 ug	EUR 339

RPN2 sgRNA CRISPR Lentivector set (Human)
K1997701	ABM	3 x 1.0 ug	EUR 339

RPN2 Ribophorin II Human Recombinant Protein
PROTP04844	BosterBio	Regular: 20ug	EUR 317
Description: RPN2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 539 amino acids (23-540) and having a molecular mass of 59.2kDa.;RPN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Ribophorin II(RPN2)ELISA Kit
QY-E03153	Qayee Biotechnology	96T	EUR 361

Rpn2 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein
EF019271	Lifescience Market	96 Tests	EUR 689

Rpn2 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei
EF016100	Lifescience Market	96 Tests	EUR 689

RPN2 ELISA Kit| Bovine Dolichyl-diphosphooligosaccharide--prote
EF011860	Lifescience Market	96 Tests	EUR 689

RPN2 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot
EF012496	Lifescience Market	96 Tests	EUR 689

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4887502	ABM	1.0 ug DNA	EUR 154

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4887503	ABM	1.0 ug DNA	EUR 154

Rpn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4887504	ABM	1.0 ug DNA	EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7093502	ABM	1.0 ug DNA	EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7093503	ABM	1.0 ug DNA	EUR 154

Rpn2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7093504	ABM	1.0 ug DNA	EUR 154

RPN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1997702	ABM	1.0 ug DNA	EUR 154

RPN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1997703	ABM	1.0 ug DNA	EUR 154

RPN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1997704	ABM	1.0 ug DNA	EUR 154

RPN2 Protein Vector (Rat) (pPB-C-His)
PV302330	ABM	500 ng	EUR 603

RPN2 Protein Vector (Rat) (pPB-N-His)
PV302331	ABM	500 ng	EUR 603

RPN2 Protein Vector (Rat) (pPM-C-HA)
PV302332	ABM	500 ng	EUR 603

RPN2 Protein Vector (Rat) (pPM-C-His)
PV302333	ABM	500 ng	EUR 603

RPN2 Protein Vector (Mouse) (pPB-C-His)
PV225526	ABM	500 ng	EUR 603

RPN2 Protein Vector (Mouse) (pPB-N-His)
PV225527	ABM	500 ng	EUR 603

RPN2 Protein Vector (Mouse) (pPM-C-HA)
PV225528	ABM	500 ng	EUR 603

RPN2 Protein Vector (Mouse) (pPM-C-His)
PV225529	ABM	500 ng	EUR 603

RPN2 Protein Vector (Human) (pPB-C-His)
PV036077	ABM	500 ng	EUR 329

RPN2 Protein Vector (Human) (pPB-N-His)
PV036078	ABM	500 ng	EUR 329

RPN2 Protein Vector (Human) (pPM-C-HA)
PV036079	ABM	500 ng	EUR 329

RPN2 Protein Vector (Human) (pPM-C-His)
PV036080	ABM	500 ng	EUR 329

Recombinant Human RPN2 Protein, His, E.coli-1mg
QP13349-1mg	EnQuireBio	1mg	EUR 3655

Recombinant Human RPN2 Protein, His, E.coli-20ug
QP13349-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RPN2 Protein, His, E.coli-5ug
QP13349-5ug	EnQuireBio	5ug	EUR 155

Rpn2 3'UTR Luciferase Stable Cell Line
TU118122	ABM	1.0 ml	Ask for price

Rpn2 3'UTR GFP Stable Cell Line
TU168122	ABM	1.0 ml	Ask for price

Rpn2 3'UTR Luciferase Stable Cell Line
TU219664	ABM	1.0 ml	Ask for price

Rpn2 3'UTR GFP Stable Cell Line
TU269664	ABM	1.0 ml	Ask for price

RPN2 3'UTR GFP Stable Cell Line
TU071658	ABM	1.0 ml	EUR 1394

RPN2 3'UTR Luciferase Stable Cell Line
TU021658	ABM	1.0 ml	EUR 1394

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody
20-abx006133	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody
abx145853-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody
abx237451-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 2 (RPN2) Antibody
20-abx321910	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

RPN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV694999	ABM	1.0 ug DNA	EUR 682

RPN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695003	ABM	1.0 ug DNA	EUR 682