RPL23

RPL23 antibody
70R-19971	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL23 antibody

RPL23 Antibody
1-CSB-PA070295	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL23. Recognizes RPL23 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL23 Antibody
DF3702	Affbiotech	200ul	EUR 304
Description: RPL23 Antibody detects endogenous levels of total RPL23.

RPL23 antibody
70R-33947	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL23 antibody

RPL23 Antibody
1-CSB-PA020186GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL23. Recognizes RPL23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL23 siRNA
20-abx904655	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23 siRNA
20-abx931939	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23 siRNA
20-abx931940	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL23 Antibody
ABD3702	Lifescience Market	100 ug	EUR 438

RPL23 Polyclonal Antibody
30541-100ul	SAB	100ul	EUR 252

RPL23 Polyclonal Antibody
30541-50ul	SAB	50ul	EUR 187

RPL23 Blocking Peptide
DF3702-BP	Affbiotech	1mg	EUR 195

RPL23 cloning plasmid
CSB-CL020186HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 423 Sequence: atgtcgaagcgaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttccggtaggagctgtaatcaattgtgctgacaacacaggagccaaaaacctgtatatcatctccgtgaaggggatcaagggacggctgaacagacttcccgctgctggtgtgggtga Show more
Description: A cloning plasmid for the RPL23 gene.

RPL23 cloning plasmid
CSB-CL020186HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 423 Sequence: atgtcgaagcgaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttccggtaggagctgtaatcaattgtgctgacaacacaggagccaaaaacctgtatatcatctccgtgaaggggatcaagggacggctgaacagacttcccgctgctggtgtgggtga Show more
Description: A cloning plasmid for the RPL23 gene.

RPL23 Rabbit pAb
A4292-100ul	Abclonal	100 ul	EUR 308

RPL23 Rabbit pAb
A4292-200ul	Abclonal	200 ul	EUR 459

RPL23 Rabbit pAb
A4292-20ul	Abclonal	20 ul	EUR 183

RPL23 Rabbit pAb
A4292-50ul	Abclonal	50 ul	EUR 223

anti- RPL23 antibody
FNab07422	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L23 Uniprot ID: P62829 Gene ID: 9349 Research Area: Metabolism
Description: Antibody raised against RPL23

Anti-RPL23 antibody
PAab07422	Lifescience Market	100 ug	EUR 386

Anti-RPL23 antibody
STJ111217	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL17 because the encoded protein shares amino acid identity with ribosomal protein L17 from Saccharomyces cerevisiae; however, its official symbol is RPL23. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL23 antibody
STJ72915	St John's Laboratory	100 µg	EUR 359

Canine RPL23 ELISA KIT
ELI-30296d	Lifescience Market	96 Tests	EUR 928

RPL23 ELISA KIT|Human
EF002579	Lifescience Market	96 Tests	EUR 689

Mouse RPL23 shRNA Plasmid
20-abx975320	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPL23 shRNA Plasmid
20-abx985401	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL23 Polyclonal Conjugated Antibody
C30541	SAB	100ul	EUR 397

Human RPL23 shRNA Plasmid
20-abx956187	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL23 Recombinant Protein (Human)
RP026902	ABM	100 ug	Ask for price

RPL23 Recombinant Protein (Human)
RP026905	ABM	100 ug	Ask for price

RPL23 Recombinant Protein (Mouse)
RP169001	ABM	100 ug	Ask for price

RPL23 Recombinant Protein (Rat)
RP226637	ABM	100 ug	Ask for price

Ribosomal Protein L23 (RPL23) Antibody
abx026897-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody
abx026897-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody
20-abx115232	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody
20-abx135736	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody
abx237422-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L23 (RPL23) Antibody
20-abx329991	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody
abx432063-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Rpl23 ORF Vector (Rat) (pORF)
ORF075547	ABM	1.0 ug DNA	EUR 506

RPL23 ORF Vector (Human) (pORF)
ORF008968	ABM	1.0 ug DNA	EUR 95

RPL23 ORF Vector (Human) (pORF)
ORF008969	ABM	1.0 ug DNA	EUR 95

Rpl23 ORF Vector (Mouse) (pORF)
ORF056335	ABM	1.0 ug DNA	EUR 506

Rpl23 sgRNA CRISPR Lentivector set (Mouse)
K4917201	ABM	3 x 1.0 ug	EUR 339

Rpl23 sgRNA CRISPR Lentivector set (Rat)
K6872901	ABM	3 x 1.0 ug	EUR 339

RPL23 sgRNA CRISPR Lentivector set (Human)
K1938301	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L23 (RPL23) ELISA Kit
abx382907-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4917202	ABM	1.0 ug DNA	EUR 154

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4917203	ABM	1.0 ug DNA	EUR 154

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4917204	ABM	1.0 ug DNA	EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6872902	ABM	1.0 ug DNA	EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6872903	ABM	1.0 ug DNA	EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6872904	ABM	1.0 ug DNA	EUR 154

RPL23 sgRNA CRISPR Lentivector (Human) (Target 1)
K1938302	ABM	1.0 ug DNA	EUR 154

RPL23 sgRNA CRISPR Lentivector (Human) (Target 2)
K1938303	ABM	1.0 ug DNA	EUR 154

RPL23 sgRNA CRISPR Lentivector (Human) (Target 3)
K1938304	ABM	1.0 ug DNA	EUR 154

RPL23 Protein Vector (Rat) (pPB-C-His)
PV302186	ABM	500 ng	EUR 603

RPL23 Protein Vector (Rat) (pPB-N-His)
PV302187	ABM	500 ng	EUR 603

RPL23 Protein Vector (Rat) (pPM-C-HA)
PV302188	ABM	500 ng	EUR 603

RPL23 Protein Vector (Rat) (pPM-C-His)
PV302189	ABM	500 ng	EUR 603

RPL23 Protein Vector (Human) (pPB-C-His)
PV035869	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPB-N-His)
PV035870	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPM-C-HA)
PV035871	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPM-C-His)
PV035872	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPB-C-His)
PV035873	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPB-N-His)
PV035874	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPM-C-HA)
PV035875	ABM	500 ng	EUR 329

RPL23 Protein Vector (Human) (pPM-C-His)
PV035876	ABM	500 ng	EUR 329

RPL23 Protein Vector (Mouse) (pPB-C-His)
PV225338	ABM	500 ng	EUR 603

RPL23 Protein Vector (Mouse) (pPB-N-His)
PV225339	ABM	500 ng	EUR 603

RPL23 Protein Vector (Mouse) (pPM-C-HA)
PV225340	ABM	500 ng	EUR 603

RPL23 Protein Vector (Mouse) (pPM-C-His)
PV225341	ABM	500 ng	EUR 603

Rpl23 3'UTR Luciferase Stable Cell Line
TU118085	ABM	1.0 ml	Ask for price

Rpl23 3'UTR GFP Stable Cell Line
TU168085	ABM	1.0 ml	Ask for price

Rpl23 3'UTR Luciferase Stable Cell Line
TU219628	ABM	1.0 ml	Ask for price

Rpl23 3'UTR GFP Stable Cell Line
TU269628	ABM	1.0 ml	Ask for price

RPL23 3'UTR GFP Stable Cell Line
TU071064	ABM	1.0 ml	EUR 1521

RPL23 3'UTR Luciferase Stable Cell Line
TU021064	ABM	1.0 ml	EUR 1521

Rabbit 60S ribosomal protein L23(RPL23) ELISA kit
E04R0443-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23(RPL23) ELISA kit
E04R0443-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23(RPL23) ELISA kit
E04R0443-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23(RPL23) ELISA kit
E02R0443-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23(RPL23) ELISA kit
E02R0443-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23(RPL23) ELISA kit
E02R0443-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23(RPL23) ELISA kit
E03R0443-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.