  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL23 antibody

70R-33947 100 ug
EUR 327
Description: Rabbit polyclonal RPL23 antibody

RPL23 Antibody

ABD3702 100 ug
EUR 438

RPL23 antibody

70R-19971 50 ul
EUR 435
Description: Rabbit polyclonal RPL23 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL23 Antibody

DF3702 200ul
EUR 304
Description: RPL23 Antibody detects endogenous levels of total RPL23.

RPL23 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL23. Recognizes RPL23 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL23 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL23. Recognizes RPL23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL23 cloning plasmid

CSB-CL020186HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgtcgaagcgaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttccggtaggagctgtaatcaattgtgctgacaacacaggagccaaaaacctgtatatcatctccgtgaaggggatcaagggacggctgaacagacttcccgctgctggtgtgggtga
  • Show more
Description: A cloning plasmid for the RPL23 gene.

RPL23 cloning plasmid

CSB-CL020186HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgtcgaagcgaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttccggtaggagctgtaatcaattgtgctgacaacacaggagccaaaaacctgtatatcatctccgtgaaggggatcaagggacggctgaacagacttcccgctgctggtgtgggtga
  • Show more
Description: A cloning plasmid for the RPL23 gene.

anti- RPL23 antibody

FNab07422 100µg
EUR 548.75
  • Immunogen: ribosomal protein L23
  • Uniprot ID: P62829
  • Gene ID: 9349
  • Research Area: Metabolism
Description: Antibody raised against RPL23

RPL23 Rabbit pAb

A4292-100ul 100 ul
EUR 308

RPL23 Rabbit pAb

A4292-200ul 200 ul
EUR 459

RPL23 Rabbit pAb

A4292-20ul 20 ul
EUR 183

RPL23 Rabbit pAb

A4292-50ul 50 ul
EUR 223

RPL23 Polyclonal Antibody

30541-100ul 100ul
EUR 252

RPL23 Polyclonal Antibody

30541-50ul 50ul
EUR 187

RPL23 Blocking Peptide

DF3702-BP 1mg
EUR 195

Anti-RPL23 antibody

PAab07422 100 ug
EUR 386

Anti-RPL23 antibody

STJ72915 100 µg
EUR 359

Anti-RPL23 antibody

STJ111217 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL17 because the encoded protein shares amino acid identity with ribosomal protein L17 from Saccharomyces cerevisiae; however, its official symbol is RPL23. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

RPL23 Polyclonal Conjugated Antibody

C30541 100ul
EUR 397

Mouse RPL23 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL23 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002579 96 Tests
EUR 689


ELI-30296d 96 Tests
EUR 928

Human RPL23 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL23 Recombinant Protein (Human)

RP026902 100 ug Ask for price

RPL23 Recombinant Protein (Human)

RP026905 100 ug Ask for price

RPL23 Recombinant Protein (Rat)

RP226637 100 ug Ask for price

RPL23 Recombinant Protein (Mouse)

RP169001 100 ug Ask for price

Ribosomal Protein L23 (RPL23) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody

abx026897-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody

abx026897-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L23 (RPL23) Antibody

abx432063-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ribosomal Protein L23 (RPL23) Antibody

abx237422-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL23 ORF Vector (Human) (pORF)

ORF008968 1.0 ug DNA
EUR 95

RPL23 ORF Vector (Human) (pORF)

ORF008969 1.0 ug DNA
EUR 95

Rpl23 ORF Vector (Mouse) (pORF)

ORF056335 1.0 ug DNA
EUR 506

Rpl23 ORF Vector (Rat) (pORF)

ORF075547 1.0 ug DNA
EUR 506

RPL23 sgRNA CRISPR Lentivector set (Human)

K1938301 3 x 1.0 ug
EUR 339

Rpl23 sgRNA CRISPR Lentivector set (Mouse)

K4917201 3 x 1.0 ug
EUR 339

Rpl23 sgRNA CRISPR Lentivector set (Rat)

K6872901 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L23 (RPL23) ELISA Kit

abx382907-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL23 sgRNA CRISPR Lentivector (Human) (Target 1)

K1938302 1.0 ug DNA
EUR 154

RPL23 sgRNA CRISPR Lentivector (Human) (Target 2)

K1938303 1.0 ug DNA
EUR 154

RPL23 sgRNA CRISPR Lentivector (Human) (Target 3)

K1938304 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4917202 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4917203 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4917204 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6872902 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6872903 1.0 ug DNA
EUR 154

Rpl23 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6872904 1.0 ug DNA
EUR 154

RPL23 Protein Vector (Human) (pPB-C-His)

PV035869 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPB-N-His)

PV035870 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPM-C-HA)

PV035871 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPM-C-His)

PV035872 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPB-C-His)

PV035873 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPB-N-His)

PV035874 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPM-C-HA)

PV035875 500 ng
EUR 329

RPL23 Protein Vector (Human) (pPM-C-His)

PV035876 500 ng
EUR 329

RPL23 Protein Vector (Rat) (pPB-C-His)

PV302186 500 ng
EUR 603

RPL23 Protein Vector (Rat) (pPB-N-His)

PV302187 500 ng
EUR 603

RPL23 Protein Vector (Rat) (pPM-C-HA)

PV302188 500 ng
EUR 603

RPL23 Protein Vector (Rat) (pPM-C-His)

PV302189 500 ng
EUR 603

RPL23 Protein Vector (Mouse) (pPB-C-His)

PV225338 500 ng
EUR 603

RPL23 Protein Vector (Mouse) (pPB-N-His)

PV225339 500 ng
EUR 603

RPL23 Protein Vector (Mouse) (pPM-C-HA)

PV225340 500 ng
EUR 603

RPL23 Protein Vector (Mouse) (pPM-C-His)

PV225341 500 ng
EUR 603

Rpl23 3'UTR GFP Stable Cell Line

TU168085 1.0 ml Ask for price

RPL23 3'UTR Luciferase Stable Cell Line

TU021064 1.0 ml
EUR 1521

Rpl23 3'UTR Luciferase Stable Cell Line

TU118085 1.0 ml Ask for price

RPL23 3'UTR GFP Stable Cell Line

TU071064 1.0 ml
EUR 1521

Rpl23 3'UTR Luciferase Stable Cell Line

TU219628 1.0 ml Ask for price

Rpl23 3'UTR GFP Stable Cell Line

TU269628 1.0 ml Ask for price

Rat 60S ribosomal protein L23(RPL23) ELISA kit

E02R0443-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23(RPL23) ELISA kit

E02R0443-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L23(RPL23) ELISA kit

E02R0443-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23(RPL23) ELISA kit

E03R0443-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23(RPL23) ELISA kit

E03R0443-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L23(RPL23) ELISA kit

E03R0443-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L23(RPL23) ELISA kit

E04R0443-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L23(RPL23) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.