PSMA5

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit

DLR-PSMa5-Hu-96T 96T
EUR 673
  • Should the Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Proteasome Subunit Alpha Type 5 (PSMa5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit

RDR-PSMa5-Hu-48Tests 48 Tests
EUR 544

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit

RDR-PSMa5-Hu-96Tests 96 Tests
EUR 756

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit

RD-PSMa5-Hu-48Tests 48 Tests
EUR 521

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit

RD-PSMa5-Hu-96Tests 96 Tests
EUR 723

Psma5/ Rat Psma5 ELISA Kit

ELI-37871r 96 Tests
EUR 886

PSMA5 Antibody

33017-100ul 100ul
EUR 252

PSMA5 antibody

10-2569 250 ug
EUR 492
Description: Mouse monoclonal PSMA5 antibody

PSMA5 Antibody

DF8268 200ul
EUR 304
Description: PSMA5 Antibody detects endogenous levels of total PSMA5.

PSMA5 antibody

70R-4325 50 ug
EUR 467
Description: Rabbit polyclonal PSMA5 antibody

PSMA5 antibody

70R-4326 50 ug
EUR 467
Description: Rabbit polyclonal PSMA5 antibody

PSMA5 Antibody

1-CSB-PA018870LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

PSMA5 siRNA

20-abx904307
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA5 siRNA

20-abx930130
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA5 siRNA

20-abx930131
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA5 Antibody

ABD8268 100 ug
EUR 438

PSMA5 Antibody

ABD8298 100 ug
EUR 438

PSMA5 Rabbit pAb

A14053-100ul 100 ul
EUR 308

PSMA5 Rabbit pAb

A14053-200ul 200 ul
EUR 459

PSMA5 Rabbit pAb

A14053-20ul 20 ul
EUR 183

PSMA5 Rabbit pAb

A14053-50ul 50 ul
EUR 223

PSMA5 Blocking Peptide

33R-2904 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA5 antibody, catalog no. 70R-4326

PSMA5 Blocking Peptide

33R-5998 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA5 antibody, catalog no. 70R-4325

PSMA5 Blocking Peptide

DF8268-BP 1mg
EUR 195

PSMA5 Conjugated Antibody

C33017 100ul
EUR 397

PSMA5 cloning plasmid

CSB-CL018870HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: ATGTTTCTTACCCGGTCTGAGTACGACAGGGGCGTGAATACTTTTTCTCCCGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGGATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACTTCCCCACTGAT
  • Show more
Description: A cloning plasmid for the PSMA5 gene.

PSMA5 Rabbit pAb

A5752-100ul 100 ul
EUR 308

PSMA5 Rabbit pAb

A5752-200ul 200 ul
EUR 459

PSMA5 Rabbit pAb

A5752-20ul 20 ul
EUR 183

PSMA5 Rabbit pAb

A5752-50ul 50 ul
EUR 223

Anti-PSMA5 antibody

STJ28319 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene.

Anti-PSMA5 antibody

STJ115988 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene.

Polyclonal PSMA5 Antibody (Center)

APR03965G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA5 (Center). This antibody is tested and proven to work in the following applications:

PSMA5 protein (His tag)

80R-2078 10 ug
EUR 322
Description: Recombinant human PSMA5 protein (His tag)

Mouse PSMA5 shRNA Plasmid

20-abx973722
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMA5 shRNA Plasmid

20-abx985658
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMA5 Antibody, HRP conjugated

1-CSB-PA018870LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMA5 Antibody, FITC conjugated

1-CSB-PA018870LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMA5 Antibody, Biotin conjugated

1-CSB-PA018870LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMA5 shRNA Plasmid

20-abx953833
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMA5 Recombinant Protein (Human)

RP042562 100 ug Ask for price

PSMA5 Recombinant Protein (Mouse)

RP165248 100 ug Ask for price

PSMA5 Recombinant Protein (Rat)

RP222593 100 ug Ask for price

Polyclonal PSMA5 Antibody (N-term)

APR03964G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA5 (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal PSMA5 Antibody, Clone: 426CT8.5.1

AMM02407G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human PSMA5. The antibodies are raised in Mouse and are from clone 426CT8.5.1. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal PSMA5 Antibody, Clone: 426CT32.1.2

AMM02564G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human PSMA5. The antibodies are raised in Mouse and are from clone 426CT32.1.2. This antibody is applicable in WB, E

Psma5 ORF Vector (Rat) (pORF)

ORF074199 1.0 ug DNA
EUR 506

PSMA5 ORF Vector (Human) (pORF)

ORF014188 1.0 ug DNA
EUR 354

Psma5 ORF Vector (Mouse) (pORF)

ORF055084 1.0 ug DNA
EUR 506

pECMV-Psma5-m-FLAG Plasmid

PVT15523 2 ug
EUR 325

[One Step] PSMA5 Antibody Kit

RK05688 50 ul
EUR 240

PSMA5 ELISA Kit (Human) (OKCD00992)

OKCD00992 96 Wells
EUR 831
Description: Description of target: The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL

Monoclonal PSMA5 Antibody (Ascites), Clone: 426CT8.5.1

AMM02406G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human PSMA5 (Ascites). The antibodies are raised in Mouse and are from clone 426CT8.5.1. This antibody is applicable in WB, E

Psma5 sgRNA CRISPR Lentivector set (Rat)

K6844401 3 x 1.0 ug
EUR 339

Psma5 sgRNA CRISPR Lentivector set (Mouse)

K3985101 3 x 1.0 ug
EUR 339