PSMA5

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit
DLR-PSMa5-Hu-96T	DL Develop	96T	EUR 673
Should the Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Proteasome Subunit Alpha Type 5 (PSMa5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit
RD-PSMa5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit
RD-PSMa5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit
RDR-PSMa5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Proteasome Subunit Alpha Type 5 (PSMa5) ELISA Kit
RDR-PSMa5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Psma5/ Rat Psma5 ELISA Kit
ELI-37871r	Lifescience Market	96 Tests	EUR 886

PSMA5 siRNA
20-abx904307	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMA5 siRNA
20-abx930130	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMA5 siRNA
20-abx930131	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMA5 antibody
70R-4325	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PSMA5 antibody

PSMA5 antibody
70R-4326	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PSMA5 antibody

PSMA5 Antibody
ABD8268	Lifescience Market	100 ug	EUR 438

PSMA5 Antibody
ABD8298	Lifescience Market	100 ug	EUR 438

PSMA5 antibody
10-2569	Fitzgerald	250 ug	EUR 492
Description: Mouse monoclonal PSMA5 antibody

PSMA5 Antibody
33017-100ul	SAB	100ul	EUR 252

PSMA5 Antibody
DF8268	Affbiotech	200ul	EUR 304
Description: PSMA5 Antibody detects endogenous levels of total PSMA5.

PSMA5 Antibody
1-CSB-PA018870LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

PSMA5 Conjugated Antibody
C33017	SAB	100ul	EUR 397

PSMA5 cloning plasmid
CSB-CL018870HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 726 Sequence: ATGTTTCTTACCCGGTCTGAGTACGACAGGGGCGTGAATACTTTTTCTCCCGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGGATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACTTCCCCACTGAT Show more
Description: A cloning plasmid for the PSMA5 gene.

PSMA5 Rabbit pAb
A5752-100ul	Abclonal	100 ul	EUR 308

PSMA5 Rabbit pAb
A5752-200ul	Abclonal	200 ul	EUR 459

PSMA5 Rabbit pAb
A5752-20ul	Abclonal	20 ul	EUR 183

PSMA5 Rabbit pAb
A5752-50ul	Abclonal	50 ul	EUR 223

PSMA5 Rabbit pAb
A14053-100ul	Abclonal	100 ul	EUR 308

PSMA5 Rabbit pAb
A14053-200ul	Abclonal	200 ul	EUR 459

PSMA5 Rabbit pAb
A14053-20ul	Abclonal	20 ul	EUR 183

PSMA5 Rabbit pAb
A14053-50ul	Abclonal	50 ul	EUR 223

PSMA5 Blocking Peptide
33R-5998	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA5 antibody, catalog no. 70R-4325

PSMA5 Blocking Peptide
33R-2904	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA5 antibody, catalog no. 70R-4326

PSMA5 Blocking Peptide
DF8268-BP	Affbiotech	1mg	EUR 195

Anti-PSMA5 antibody
STJ28319	St John's Laboratory	100 µl	EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene.

Anti-PSMA5 antibody
STJ115988	St John's Laboratory	100 µl	EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene.

Polyclonal PSMA5 Antibody (Center)
APR03965G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA5 (Center). This antibody is tested and proven to work in the following applications:

Mouse PSMA5 shRNA Plasmid
20-abx973722	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PSMA5 shRNA Plasmid
20-abx985658	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PSMA5 shRNA Plasmid
20-abx953833	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSMA5 protein (His tag)
80R-2078	Fitzgerald	10 ug	EUR 322
Description: Recombinant human PSMA5 protein (His tag)

PSMA5 Antibody, HRP conjugated
1-CSB-PA018870LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMA5 Antibody, FITC conjugated
1-CSB-PA018870LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMA5 Antibody, Biotin conjugated
1-CSB-PA018870LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA5. Recognizes PSMA5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMA5 Recombinant Protein (Human)
RP042562	ABM	100 ug	Ask for price

PSMA5 Recombinant Protein (Rat)
RP222593	ABM	100 ug	Ask for price

PSMA5 Recombinant Protein (Mouse)
RP165248	ABM	100 ug	Ask for price

Polyclonal PSMA5 Antibody (N-term)
APR03964G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA5 (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal PSMA5 Antibody, Clone: 426CT8.5.1
AMM02407G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human PSMA5. The antibodies are raised in Mouse and are from clone 426CT8.5.1. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal PSMA5 Antibody, Clone: 426CT32.1.2
AMM02564G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human PSMA5. The antibodies are raised in Mouse and are from clone 426CT32.1.2. This antibody is applicable in WB, E

Psma5 ORF Vector (Rat) (pORF)
ORF074199	ABM	1.0 ug DNA	EUR 506

PSMA5 ORF Vector (Human) (pORF)
ORF014188	ABM	1.0 ug DNA	EUR 354

Psma5 ORF Vector (Mouse) (pORF)
ORF055084	ABM	1.0 ug DNA	EUR 506

[One Step] PSMA5 Antibody Kit
RK05688	Abclonal	50 ul	EUR 240

pECMV-Psma5-m-FLAG Plasmid
PVT15523	Lifescience Market	2 ug	EUR 325

PSMA5 ELISA Kit (Human) (OKCD00992)
OKCD00992	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL

Monoclonal PSMA5 Antibody (Ascites), Clone: 426CT8.5.1
AMM02406G	Leading Biology	0.1 ml	EUR 484
Description: A Monoclonal antibody against Human PSMA5 (Ascites). The antibodies are raised in Mouse and are from clone 426CT8.5.1. This antibody is applicable in WB, E

PSMA5 sgRNA CRISPR Lentivector set (Human)
K1738801	ABM	3 x 1.0 ug	EUR 339

Psma5 sgRNA CRISPR Lentivector set (Mouse)
K3985101	ABM	3 x 1.0 ug	EUR 339