PRKCSH

PRKCSH antibody
70R-19527	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PRKCSH antibody

PRKCSH antibody
70R-12623	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal PRKCSH antibody

PRKCSH antibody
70R-15358	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PRKCSH antibody

PRKCSH Antibody
1-CSB-PA002713	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

PRKCSH Antibody
CSB-PA585384-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

PRKCSH Antibody
CSB-PA585384-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

PRKCSH Antibody
1-CSB-PA02925A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRKCSH Antibody
1-CSB-PA018709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRKCSH siRNA
20-abx929777	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRKCSH siRNA
20-abx929778	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PRKCSH
YF-PA14000	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PRKCSH

anti-PRKCSH
YF-PA14001	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PRKCSH

anti-PRKCSH
YF-PA14002	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to PRKCSH

anti-PRKCSH
YF-PA14003	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PRKCSH

PRKCSH antibody (HRP)
60R-1888	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PRKCSH antibody (HRP)

PRKCSH antibody (FITC)
60R-1889	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PRKCSH antibody (FITC)

PRKCSH antibody (biotin)
60R-1890	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PRKCSH antibody (biotin)

PRKCSH cloning plasmid
CSB-CL018709HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1197 Sequence: atggccgaggtcacccgcgaagggttccgtctgaagaagatccttattgaggactggaagaaggcacgggaggagaagcagaaaaagctcattgagctacaggctgggaagaagtctctggaagaccaggtggagatgctgcggacagtgaaggaggaagctgagaagccagaga Show more
Description: A cloning plasmid for the PRKCSH gene.

PRKCSH Rabbit pAb
A4045-100ul	Abclonal	100 ul	EUR 308

PRKCSH Rabbit pAb
A4045-200ul	Abclonal	200 ul	EUR 459

PRKCSH Rabbit pAb
A4045-20ul	Abclonal	20 ul	Ask for price

PRKCSH Rabbit pAb
A4045-50ul	Abclonal	50 ul	Ask for price

PRKCSH Polyclonal Antibody
A51833	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- PRKCSH antibody
FNab06784	FN Test	100µg	EUR 505.25
Immunogen: protein kinase C substrate 80K-H Uniprot ID: P14314 Gene ID: 5589 Research Area: Metabolism
Description: Antibody raised against PRKCSH

Anti-PRKCSH antibody
PAab06784	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-PRKCSH
PVT12866	Lifescience Market	2 ug	EUR 391

Anti-PRKCSH antibody
STJ25135	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants.

Anti-PRKCSH (3H7)
YF-MA14893	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PRKCSH

PRKCSH Antibody, HRP conjugated
1-CSB-PA02925B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCSH Antibody, FITC conjugated
1-CSB-PA02925C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCSH Antibody, Biotin conjugated
1-CSB-PA02925D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PRKCSH ELISA Kit
ELA-E3190h	Lifescience Market	96 Tests	EUR 824

PRKCSH ELISA KIT|Human
EF006323	Lifescience Market	96 Tests	EUR 689

Mouse PRKCSH shRNA Plasmid
20-abx972197	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PRKCSH shRNA Plasmid
20-abx953759	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PRKCSH Recombinant Protein (Human)
RP024640	ABM	100 ug	Ask for price

PRKCSH Recombinant Protein (Mouse)
RP164465	ABM	100 ug	Ask for price

PRKCSH Recombinant Protein (Rat)
RP222086	ABM	100 ug	Ask for price

Polyclonal PRKCSH Antibody (N-term)
AMM07333G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCSH (N-term). This antibody is tested and proven to work in the following applications:

PRKCSH Polyclonal Antibody, HRP Conjugated
A51834	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PRKCSH Polyclonal Antibody, FITC Conjugated
A51835	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PRKCSH Polyclonal Antibody, Biotin Conjugated
A51836	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Prkcsh ORF Vector (Rat) (pORF)
ORF074030	ABM	1.0 ug DNA	EUR 506

PRKCSH ORF Vector (Human) (pORF)
ORF008214	ABM	1.0 ug DNA	EUR 95

Prkcsh ORF Vector (Mouse) (pORF)
ORF054823	ABM	1.0 ug DNA	EUR 506

PRKCSH ELISA Kit (Bovine) (OKEH08543)
OKEH08543	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39ng/mL

PRKCSH ELISA Kit (Human) (OKEH01694)
OKEH01694	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.24 ng/mL

Human Glucosidase 2 subunit beta (PRKCSH)
1-CSB-RP029254h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 59.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucosidase 2 subunit beta(PRKCSH),partial expressed in E.coli

Glucosidase 2 Subunit Beta (PRKCSH) Antibody
20-abx109818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polyclonal PRKCSH antibody - N-terminal region
AMM07334G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCSH - N-terminal region. This antibody is tested and proven to work in the following applications:

Prkcsh sgRNA CRISPR Lentivector set (Rat)
K6696601	ABM	3 x 1.0 ug	EUR 339

Prkcsh sgRNA CRISPR Lentivector set (Mouse)
K4590401	ABM	3 x 1.0 ug	EUR 339

PRKCSH sgRNA CRISPR Lentivector set (Human)
K1722301	ABM	3 x 1.0 ug	EUR 339

Prkcsh sgRNA CRISPR Lentivector (Rat) (Target 1)
K6696602	ABM	1.0 ug DNA	EUR 154

Prkcsh sgRNA CRISPR Lentivector (Rat) (Target 2)
K6696603	ABM	1.0 ug DNA	EUR 154