PRKCSH

PRKCSH antibody

70R-19527 50 ul
EUR 435
Description: Rabbit polyclonal PRKCSH antibody

PRKCSH antibody

70R-12623 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PRKCSH antibody

PRKCSH antibody

70R-15358 100 ug
EUR 327
Description: Rabbit polyclonal PRKCSH antibody

PRKCSH Antibody

1-CSB-PA002713
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

PRKCSH Antibody

CSB-PA585384-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

PRKCSH Antibody

CSB-PA585384-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

PRKCSH Antibody

1-CSB-PA02925A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRKCSH Antibody

1-CSB-PA018709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRKCSH siRNA

20-abx929777
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKCSH siRNA

20-abx929778
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PRKCSH

YF-PA14000 50 ul
EUR 363
Description: Mouse polyclonal to PRKCSH

anti-PRKCSH

YF-PA14001 50 ug
EUR 363
Description: Mouse polyclonal to PRKCSH

anti-PRKCSH

YF-PA14002 100 ul
EUR 403
Description: Rabbit polyclonal to PRKCSH

anti-PRKCSH

YF-PA14003 100 ug
EUR 403
Description: Rabbit polyclonal to PRKCSH

PRKCSH antibody (HRP)

60R-1888 100 ug
EUR 327
Description: Rabbit polyclonal PRKCSH antibody (HRP)

PRKCSH antibody (FITC)

60R-1889 100 ug
EUR 327
Description: Rabbit polyclonal PRKCSH antibody (FITC)

PRKCSH antibody (biotin)

60R-1890 100 ug
EUR 327
Description: Rabbit polyclonal PRKCSH antibody (biotin)

PRKCSH cloning plasmid

CSB-CL018709HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1197
  • Sequence: atggccgaggtcacccgcgaagggttccgtctgaagaagatccttattgaggactggaagaaggcacgggaggagaagcagaaaaagctcattgagctacaggctgggaagaagtctctggaagaccaggtggagatgctgcggacagtgaaggaggaagctgagaagccagaga
  • Show more
Description: A cloning plasmid for the PRKCSH gene.

PRKCSH Rabbit pAb

A4045-100ul 100 ul
EUR 308

PRKCSH Rabbit pAb

A4045-200ul 200 ul
EUR 459

PRKCSH Rabbit pAb

A4045-20ul 20 ul Ask for price

PRKCSH Rabbit pAb

A4045-50ul 50 ul Ask for price

PRKCSH Polyclonal Antibody

A51833 100 µg
EUR 570.55
Description: The best epigenetics products

anti- PRKCSH antibody

FNab06784 100µg
EUR 505.25
  • Immunogen: protein kinase C substrate 80K-H
  • Uniprot ID: P14314
  • Gene ID: 5589
  • Research Area: Metabolism
Description: Antibody raised against PRKCSH

Anti-PRKCSH antibody

PAab06784 100 ug
EUR 355

pCMV-SPORT6-PRKCSH

PVT12866 2 ug
EUR 391

Anti-PRKCSH antibody

STJ25135 100 µl
EUR 277
Description: This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants.

Anti-PRKCSH (3H7)

YF-MA14893 100 ug
EUR 363
Description: Mouse monoclonal to PRKCSH

PRKCSH Antibody, HRP conjugated

1-CSB-PA02925B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCSH Antibody, FITC conjugated

1-CSB-PA02925C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCSH Antibody, Biotin conjugated

1-CSB-PA02925D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCSH. Recognizes PRKCSH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PRKCSH ELISA Kit

ELA-E3190h 96 Tests
EUR 824

PRKCSH ELISA KIT|Human

EF006323 96 Tests
EUR 689

Mouse PRKCSH shRNA Plasmid

20-abx972197
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRKCSH shRNA Plasmid

20-abx953759
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRKCSH Recombinant Protein (Human)

RP024640 100 ug Ask for price

PRKCSH Recombinant Protein (Mouse)

RP164465 100 ug Ask for price

PRKCSH Recombinant Protein (Rat)

RP222086 100 ug Ask for price

Polyclonal PRKCSH Antibody (N-term)

AMM07333G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCSH (N-term). This antibody is tested and proven to work in the following applications:

PRKCSH Polyclonal Antibody, HRP Conjugated

A51834 100 µg
EUR 570.55
Description: kits suitable for this type of research

PRKCSH Polyclonal Antibody, FITC Conjugated

A51835 100 µg
EUR 570.55
Description: fast delivery possible

PRKCSH Polyclonal Antibody, Biotin Conjugated

A51836 100 µg
EUR 570.55
Description: reagents widely cited

Prkcsh ORF Vector (Rat) (pORF)

ORF074030 1.0 ug DNA
EUR 506

PRKCSH ORF Vector (Human) (pORF)

ORF008214 1.0 ug DNA
EUR 95

Prkcsh ORF Vector (Mouse) (pORF)

ORF054823 1.0 ug DNA
EUR 506

PRKCSH ELISA Kit (Bovine) (OKEH08543)

OKEH08543 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39ng/mL

PRKCSH ELISA Kit (Human) (OKEH01694)

OKEH01694 96 Wells
EUR 662
Description: Description of target: This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.24 ng/mL

Human Glucosidase 2 subunit beta (PRKCSH)

1-CSB-RP029254h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glucosidase 2 subunit beta(PRKCSH),partial expressed in E.coli

Glucosidase 2 Subunit Beta (PRKCSH) Antibody

20-abx109818
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal PRKCSH antibody - N-terminal region

AMM07334G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCSH - N-terminal region. This antibody is tested and proven to work in the following applications:

Prkcsh sgRNA CRISPR Lentivector set (Rat)

K6696601 3 x 1.0 ug
EUR 339

Prkcsh sgRNA CRISPR Lentivector set (Mouse)

K4590401 3 x 1.0 ug
EUR 339

PRKCSH sgRNA CRISPR Lentivector set (Human)

K1722301 3 x 1.0 ug
EUR 339

Prkcsh sgRNA CRISPR Lentivector (Rat) (Target 1)

K6696602 1.0 ug DNA
EUR 154

Prkcsh sgRNA CRISPR Lentivector (Rat) (Target 2)

K6696603 1.0 ug DNA
EUR 154