PIGX

PIGX siRNA
20-abx904018	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGX siRNA
20-abx928592	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGX siRNA
20-abx928593	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGX antibody
70R-51017	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal PIGX antibody

PIGX Antibody
ABD4293	Lifescience Market	100 ug	EUR 438

PIGX Antibody
DF4293	Affbiotech	200ul	EUR 304
Description: PIGX Antibody detects endogenous levels of total PIGX.

PIGX Antibody
1-CSB-PA003785	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

PIGX Antibody
1-CSB-PA848395LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PIGX Blocking Peptide
20-abx063892	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

PIGX Polyclonal Antibody
A56855	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PIGX Rabbit pAb
A15460-100ul	Abclonal	100 ul	EUR 308

PIGX Rabbit pAb
A15460-200ul	Abclonal	200 ul	EUR 459

PIGX Rabbit pAb
A15460-20ul	Abclonal	20 ul	EUR 183

PIGX Rabbit pAb
A15460-50ul	Abclonal	50 ul	EUR 223

PIGX Polyclonal Antibody
28977-100ul	SAB	100ul	EUR 252

PIGX Polyclonal Antibody
28977-50ul	SAB	50ul	EUR 187

PIGX Blocking Peptide
DF4293-BP	Affbiotech	1mg	EUR 195

PIGX cloning plasmid
CSB-CL848395HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 654 Sequence: atgtgttctgaaattattttgaggcaagaagttttgaaagatggtttccacagagaccttttaatcaaagtgaagtttggggaaagcattgaggacttgcacacgtgccgtctcttaattaaacaggacattcctgcaggactttatgtggatccgtatgagttggcttcattacg Show more
Description: A cloning plasmid for the PIGX gene.

pBluescriptR-PIGX Plasmid
PVT17035	Lifescience Market	2 ug	EUR 325

Anti-PIGX antibody
STJ117655	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants.

PIGX Polyclonal Conjugated Antibody
C28977	SAB	100ul	EUR 397

Mouse PIGX shRNA Plasmid
20-abx977662	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PIGX shRNA Plasmid
20-abx988298	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PIGX ELISA KIT
ELI-15158h	Lifescience Market	96 Tests	EUR 824

Mouse Pigx ELISA KIT
ELI-37396m	Lifescience Market	96 Tests	EUR 865

Human PIGX shRNA Plasmid
20-abx960364	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PIGX Antibody, HRP conjugated
1-CSB-PA848395LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGX Antibody, FITC conjugated
1-CSB-PA848395LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGX Antibody, Biotin conjugated
1-CSB-PA848395LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGX Recombinant Protein (Human)
RP023485	ABM	100 ug	Ask for price

PIGX Recombinant Protein (Rat)
RP220511	ABM	100 ug	Ask for price

PIGX Recombinant Protein (Mouse)
RP162101	ABM	100 ug	Ask for price

PIGX Recombinant Protein (Mouse)
RP162104	ABM	100 ug	Ask for price

PIGX Polyclonal Antibody, HRP Conjugated
A56856	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PIGX Polyclonal Antibody, FITC Conjugated
A56857	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PIGX Polyclonal Antibody, Biotin Conjugated
A56858	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PIGX ORF Vector (Human) (pORF)
ORF007829	ABM	1.0 ug DNA	EUR 95

Pigx ORF Vector (Rat) (pORF)
ORF073505	ABM	1.0 ug DNA	EUR 506

Pigx ORF Vector (Mouse) (pORF)
ORF054035	ABM	1.0 ug DNA	EUR 506

Pigx ORF Vector (Mouse) (pORF)
ORF054036	ABM	1.0 ug DNA	EUR 506

PIGX sgRNA CRISPR Lentivector set (Human)
K1648801	ABM	3 x 1.0 ug	EUR 339

Pigx sgRNA CRISPR Lentivector set (Mouse)
K4728901	ABM	3 x 1.0 ug	EUR 339

Pigx sgRNA CRISPR Lentivector set (Rat)
K7294401	ABM	3 x 1.0 ug	EUR 339

PIGX sgRNA CRISPR Lentivector (Human) (Target 1)
K1648802	ABM	1.0 ug DNA	EUR 154

PIGX sgRNA CRISPR Lentivector (Human) (Target 2)
K1648803	ABM	1.0 ug DNA	EUR 154

PIGX sgRNA CRISPR Lentivector (Human) (Target 3)
K1648804	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4728902	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4728903	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4728904	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 1)
K7294402	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 2)
K7294403	ABM	1.0 ug DNA	EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 3)
K7294404	ABM	1.0 ug DNA	EUR 154

PIGX Protein Vector (Human) (pPB-C-His)
PV031313	ABM	500 ng	EUR 329

PIGX Protein Vector (Human) (pPB-N-His)
PV031314	ABM	500 ng	EUR 329

PIGX Protein Vector (Human) (pPM-C-HA)
PV031315	ABM	500 ng	EUR 329