PIGX

PIGX siRNA

20-abx904018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGX siRNA

20-abx928592
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGX siRNA

20-abx928593
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGX antibody

70R-51017 100 ul
EUR 244
Description: Purified Polyclonal PIGX antibody

PIGX Antibody

ABD4293 100 ug
EUR 438

PIGX Antibody

DF4293 200ul
EUR 304
Description: PIGX Antibody detects endogenous levels of total PIGX.

PIGX Antibody

1-CSB-PA003785
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

PIGX Antibody

1-CSB-PA848395LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PIGX Blocking Peptide

20-abx063892
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PIGX Polyclonal Antibody

A56855 100 µg
EUR 570.55
Description: The best epigenetics products

PIGX Rabbit pAb

A15460-100ul 100 ul
EUR 308

PIGX Rabbit pAb

A15460-200ul 200 ul
EUR 459

PIGX Rabbit pAb

A15460-20ul 20 ul
EUR 183

PIGX Rabbit pAb

A15460-50ul 50 ul
EUR 223

PIGX Polyclonal Antibody

28977-100ul 100ul
EUR 252

PIGX Polyclonal Antibody

28977-50ul 50ul
EUR 187

PIGX Blocking Peptide

DF4293-BP 1mg
EUR 195

PIGX cloning plasmid

CSB-CL848395HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgtgttctgaaattattttgaggcaagaagttttgaaagatggtttccacagagaccttttaatcaaagtgaagtttggggaaagcattgaggacttgcacacgtgccgtctcttaattaaacaggacattcctgcaggactttatgtggatccgtatgagttggcttcattacg
  • Show more
Description: A cloning plasmid for the PIGX gene.

pBluescriptR-PIGX Plasmid

PVT17035 2 ug
EUR 325

Anti-PIGX antibody

STJ117655 100 µl
EUR 277
Description: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants.

PIGX Polyclonal Conjugated Antibody

C28977 100ul
EUR 397

Mouse PIGX shRNA Plasmid

20-abx977662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PIGX shRNA Plasmid

20-abx988298
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGX ELISA KIT

ELI-15158h 96 Tests
EUR 824

Mouse Pigx ELISA KIT

ELI-37396m 96 Tests
EUR 865

Human PIGX shRNA Plasmid

20-abx960364
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGX Antibody, HRP conjugated

1-CSB-PA848395LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGX Antibody, FITC conjugated

1-CSB-PA848395LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGX Antibody, Biotin conjugated

1-CSB-PA848395LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGX. Recognizes PIGX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGX Recombinant Protein (Human)

RP023485 100 ug Ask for price

PIGX Recombinant Protein (Rat)

RP220511 100 ug Ask for price

PIGX Recombinant Protein (Mouse)

RP162101 100 ug Ask for price

PIGX Recombinant Protein (Mouse)

RP162104 100 ug Ask for price

PIGX Polyclonal Antibody, HRP Conjugated

A56856 100 µg
EUR 570.55
Description: kits suitable for this type of research

PIGX Polyclonal Antibody, FITC Conjugated

A56857 100 µg
EUR 570.55
Description: fast delivery possible

PIGX Polyclonal Antibody, Biotin Conjugated

A56858 100 µg
EUR 570.55
Description: reagents widely cited

PIGX ORF Vector (Human) (pORF)

ORF007829 1.0 ug DNA
EUR 95

Pigx ORF Vector (Rat) (pORF)

ORF073505 1.0 ug DNA
EUR 506

Pigx ORF Vector (Mouse) (pORF)

ORF054035 1.0 ug DNA
EUR 506

Pigx ORF Vector (Mouse) (pORF)

ORF054036 1.0 ug DNA
EUR 506

PIGX sgRNA CRISPR Lentivector set (Human)

K1648801 3 x 1.0 ug
EUR 339

Pigx sgRNA CRISPR Lentivector set (Mouse)

K4728901 3 x 1.0 ug
EUR 339

Pigx sgRNA CRISPR Lentivector set (Rat)

K7294401 3 x 1.0 ug
EUR 339

PIGX sgRNA CRISPR Lentivector (Human) (Target 1)

K1648802 1.0 ug DNA
EUR 154

PIGX sgRNA CRISPR Lentivector (Human) (Target 2)

K1648803 1.0 ug DNA
EUR 154

PIGX sgRNA CRISPR Lentivector (Human) (Target 3)

K1648804 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4728902 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4728903 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4728904 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 1)

K7294402 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 2)

K7294403 1.0 ug DNA
EUR 154

Pigx sgRNA CRISPR Lentivector (Rat) (Target 3)

K7294404 1.0 ug DNA
EUR 154

PIGX Protein Vector (Human) (pPB-C-His)

PV031313 500 ng
EUR 329

PIGX Protein Vector (Human) (pPB-N-His)

PV031314 500 ng
EUR 329

PIGX Protein Vector (Human) (pPM-C-HA)

PV031315 500 ng
EUR 329