PFDN2

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
DLR-PFDN2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RD-PFDN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RD-PFDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RDR-PFDN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RDR-PFDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Pfdn2/ Rat Pfdn2 ELISA Kit
ELI-44898r	Lifescience Market	96 Tests	EUR 886

PFDN2 siRNA
20-abx903954	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PFDN2 siRNA
20-abx928306	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PFDN2 siRNA
20-abx928307	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PFDN2 antibody
70R-9434	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal PFDN2 antibody

PFDN2 Antibody
47343-100ul	SAB	100ul	EUR 252

PFDN2 antibody
70R-19225	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PFDN2 antibody

PFDN2 Antibody
1-CSB-PA017813GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PFDN2 Antibody
1-CSB-PA017813LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

anti-PFDN2
YF-PA13727	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PFDN2

PFDN2 Conjugated Antibody
C47343	SAB	100ul	EUR 397

Human PFDN2 Protein
20-abx650906	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PFDN2 cloning plasmid
CSB-CL017813HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 465 Sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcga Show more
Description: A cloning plasmid for the PFDN2 gene.

anti- PFDN2 antibody
FNab06335	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: prefoldin subunit 2 Uniprot ID: Q9UHV9 Gene ID: 5202 Research Area: Metabolism
Description: Antibody raised against PFDN2

PFDN2 Rabbit pAb
A12269-100ul	Abclonal	100 ul	EUR 308

PFDN2 Rabbit pAb
A12269-200ul	Abclonal	200 ul	EUR 459

PFDN2 Rabbit pAb
A12269-20ul	Abclonal	20 ul	EUR 183

PFDN2 Rabbit pAb
A12269-50ul	Abclonal	50 ul	EUR 223

PFDN2 Polyclonal Antibody
A60238	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PFDN2 Blocking Peptide
33R-5490	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PFDN2 antibody, catalog no. 70R-9434

Anti-PFDN2 antibody
PAab06335	Lifescience Market	100 ug	EUR 412

pENTR223-PFDN2 vector
PVT11755	Lifescience Market	2 ug	EUR 304

Anti-PFDN2 antibody
STJ114159	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.

Anti-PFDN2 (2C1)
YF-MA14673	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PFDN2

PFDN2 ELISA KIT|Human
EF001698	Lifescience Market	96 Tests	EUR 689

Human PFDN2 shRNA Plasmid
20-abx953473	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PFDN2 protein (His tag)
80R-1535	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human PFDN2 protein

Mouse PFDN2 shRNA Plasmid
20-abx972006	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PFDN2 shRNA Plasmid
20-abx991149	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PFDN2 Antibody, HRP conjugated
1-CSB-PA017813LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN2 Antibody, FITC conjugated
1-CSB-PA017813LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN2 Antibody, Biotin conjugated
1-CSB-PA017813LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PFDN2 Recombinant Protein (Human)
RP023161	ABM	100 ug	Ask for price

PFDN2 Recombinant Protein (Rat)
RP220127	ABM	100 ug	Ask for price

PFDN2 Recombinant Protein (Mouse)
RP161438	ABM	100 ug	Ask for price

Polyclonal PFDN2 Antibody(C-term)
AMM07107G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN2 (C-term). This antibody is tested and proven to work in the following applications:

Prefoldin Subunit 2 (PFDN2) Antibody
20-abx126352	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody
20-abx114662	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody
abx031100-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody
abx031100-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody
abx236335-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Prefoldin Subunit 2 (PFDN2) Antibody
20-abx302732	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PFDN2 Polyclonal Antibody, Biotin Conjugated
A60239	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PFDN2 Polyclonal Antibody, FITC Conjugated
A60240	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PFDN2 Polyclonal Antibody, HRP Conjugated
A60241	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PFDN2 ORF Vector (Human) (pORF)
ORF007721	ABM	1.0 ug DNA	EUR 95

Pfdn2 ORF Vector (Rat) (pORF)
ORF073377	ABM	1.0 ug DNA	EUR 506

Pfdn2 ORF Vector (Mouse) (pORF)
ORF053814	ABM	1.0 ug DNA	EUR 506

Recombinant Prefoldin Subunit 2 (PFDN2)
4-RPE740Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UHV9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.3kDa Isoelectric Point: 6.2
Description: Recombinant Human Prefoldin Subunit 2 expressed in: E.coli

PFDN2 ELISA Kit (Human) (OKEH07714)
OKEH07714	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.183ng/mL