Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

DLR-PFDN2-Hu-96T 96T
EUR 673
  • Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RDR-PFDN2-Hu-48Tests 48 Tests
EUR 544

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RDR-PFDN2-Hu-96Tests 96 Tests
EUR 756

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RD-PFDN2-Hu-48Tests 48 Tests
EUR 521

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RD-PFDN2-Hu-96Tests 96 Tests
EUR 723

Pfdn2/ Rat Pfdn2 ELISA Kit

ELI-44898r 96 Tests
EUR 886

PFDN2 antibody

70R-19225 50 ul
EUR 435
Description: Rabbit polyclonal PFDN2 antibody

PFDN2 Antibody

47343-100ul 100ul
EUR 252

PFDN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PFDN2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

PFDN2 antibody

70R-9434 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PFDN2 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13727 50 ul
EUR 363
Description: Mouse polyclonal to PFDN2

PFDN2 Rabbit pAb

A12269-100ul 100 ul
EUR 308

PFDN2 Rabbit pAb

A12269-200ul 200 ul
EUR 459

PFDN2 Rabbit pAb

A12269-20ul 20 ul
EUR 183

PFDN2 Rabbit pAb

A12269-50ul 50 ul
EUR 223

PFDN2 Blocking Peptide

33R-5490 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PFDN2 antibody, catalog no. 70R-9434

PFDN2 Conjugated Antibody

C47343 100ul
EUR 397

Human PFDN2 Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PFDN2 cloning plasmid

CSB-CL017813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcga
  • Show more
Description: A cloning plasmid for the PFDN2 gene.

PFDN2 Polyclonal Antibody

A60238 100 µg
EUR 570.55
Description: fast delivery possible

anti- PFDN2 antibody

FNab06335 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: prefoldin subunit 2
  • Uniprot ID: Q9UHV9
  • Gene ID: 5202
  • Research Area: Metabolism
Description: Antibody raised against PFDN2

Anti-PFDN2 antibody

PAab06335 100 ug
EUR 412

pENTR223-PFDN2 vector

PVT11755 2 ug
EUR 304

Anti-PFDN2 antibody

STJ114159 100 µl
EUR 277
Description: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.

Anti-PFDN2 (2C1)

YF-MA14673 100 ug
EUR 363
Description: Mouse monoclonal to PFDN2

PFDN2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN2. Recognizes PFDN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PFDN2 protein (His tag)

80R-1535 50 ug
EUR 305
Description: Purified recombinant Human PFDN2 protein


EF001698 96 Tests
EUR 689

Rat PFDN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PFDN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PFDN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PFDN2 Recombinant Protein (Human)

RP023161 100 ug Ask for price

PFDN2 Recombinant Protein (Mouse)

RP161438 100 ug Ask for price

PFDN2 Recombinant Protein (Rat)

RP220127 100 ug Ask for price

Prefoldin Subunit 2 (PFDN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody

abx031100-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prefoldin Subunit 2 (PFDN2) Antibody

abx031100-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal PFDN2 Antibody(C-term)

AMM07107G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN2 (C-term). This antibody is tested and proven to work in the following applications:

Prefoldin Subunit 2 (PFDN2) Antibody

abx236335-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Prefoldin Subunit 2 (PFDN2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PFDN2 Polyclonal Antibody, Biotin Conjugated

A60239 100 µg
EUR 570.55
Description: reagents widely cited

PFDN2 Polyclonal Antibody, FITC Conjugated

A60240 100 µg
EUR 570.55
Description: Ask the seller for details

PFDN2 Polyclonal Antibody, HRP Conjugated

A60241 100 µg
EUR 570.55
Description: The best epigenetics products

Pfdn2 ORF Vector (Rat) (pORF)

ORF073377 1.0 ug DNA
EUR 506

PFDN2 ORF Vector (Human) (pORF)

ORF007721 1.0 ug DNA
EUR 95

Pfdn2 ORF Vector (Mouse) (pORF)

ORF053814 1.0 ug DNA
EUR 506

Recombinant Prefoldin Subunit 2 (PFDN2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHV9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.3kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Prefoldin Subunit 2 expressed in: E.coli

PFDN2 ELISA Kit (Human) (OKEH07714)

OKEH07714 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.183ng/mL