  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPSA Antibody

36123-100ul 100ul
EUR 252

NAPSA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

NAPSA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAPSA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Napsin A; Clones NAPSA/1238 & NAPSA/1239 (Concentrate)

A00131-C 1 ml
EUR 488

Napsin A; Clones NAPSA/1238 & NAPSA/1239 (Concentrate)

A00131-C.1 0.1 ml
EUR 136

NAPSA Conjugated Antibody

C36123 100ul
EUR 397

NAPSA cloning plasmid

CSB-CL015452HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1263
  • Sequence: atgtctccaccaccgctgctgcaacccctgctgctgctgctgcctctgctgaatgtggagccttccggggccacactgatccgcatccctcttcatcgagtccaacctggacgcaggaccctgaacctactgaggggatggagagaaccagcagagctccccaagttgggggccc
  • Show more
Description: A cloning plasmid for the NAPSA gene.

NAPSA Polyclonal Antibody

A54491 100 µg
EUR 570.55
Description: fast delivery possible

NAPSA Rabbit pAb

A5594-100ul 100 ul
EUR 308

NAPSA Rabbit pAb

A5594-200ul 200 ul
EUR 459

NAPSA Rabbit pAb

A5594-20ul 20 ul
EUR 183

NAPSA Rabbit pAb

A5594-50ul 50 ul
EUR 223

Anti-NAPSA Antibody

STJ501867 100 µg
EUR 476

Anti-NAPSA Antibody

STJ501868 100 µg
EUR 476

Anti-NAPSA antibody

STJ111251 100 µl
EUR 277
Description: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma.

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC551254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF555 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC551254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF555 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC611254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF660R conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC611254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF660R conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC401254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF640R conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC401254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF640R conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC431254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF543 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC431254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF543 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC471254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF647 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC471254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF647 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC051254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF405M conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC051254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF405M conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC041254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF405S conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC041254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF405S conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNUB1254-100 100uL
EUR 209
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Concentration: 0.2mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNUB1254-500 500uL
EUR 458
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Concentration: 0.2mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNUM1254-50 50uL
EUR 395
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), 1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC681254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF568 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC681254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF568 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC701254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF770 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC701254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF770 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC881254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF488A conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC881254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF488A conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC941254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF594 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC941254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF594 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCB1254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Biotin conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCB1254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Biotin conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCH1254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCH1254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC801254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF680 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC801254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF680 conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCP1254-250 250uL
EUR 383
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), PerCP conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCR1254-250 250uL
EUR 383
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), RPE conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCA1254-250 250uL
EUR 383
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), APC conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCAP1254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNCAP1254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC811254-100 100uL
EUR 199
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF680R conjugate, Concentration: 0.1mg/mL

Napsin A (Lung Adenocarcinoma Marker) (NAPSA/1238 + NAPSA/1239) Antibody

BNC811254-500 500uL
EUR 544
Description: Primary antibody against Napsin A (Lung Adenocarcinoma Marker) ( NAPSA/1238 + NAPSA/1239), CF680R conjugate, Concentration: 0.1mg/mL

Napsin A; Clones NAPSA/1238 & NAPSA/1239 (Ready-To-Use)

A00131-0002 2 ml
EUR 101

Napsin A; Clones NAPSA/1238 & NAPSA/1239 (Ready-To-Use)

A00131-0007 7 ml
EUR 178

Napsin A; Clones NAPSA/1238 & NAPSA/1239 (Ready-To-Use)

A00131-0025 25 ml
EUR 435

Human NAPSA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAPSA protein (His tag)

80R-4051 50 ug
EUR 435
Description: Recombinant Human NAPSA protein (His tag)

Mouse NAPSA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Napsin-A (NAPSA)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Napsin-A(NAPSA) expressed in E.coli

NAPSA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAPSA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAPSA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPSA. Recognizes NAPSA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAPSA Recombinant Protein (Human)

RP020686 100 ug Ask for price

NAPSA Recombinant Protein (Rat)

RP213278 100 ug Ask for price

NAPSA Recombinant Protein (Mouse)

RP153089 100 ug Ask for price

Anti-NAPSA Antibody (Biotin)

STJ501869 100 µg
EUR 586

Anti-NAPSA Antibody (FITC)

STJ501870 100 µg
EUR 586

Anti-NAPSA Antibody (Biotin)

STJ501871 100 µg
EUR 586

Anti-NAPSA Antibody (FITC)

STJ501872 100 µg
EUR 586

Anti-Napsin A Antibody Clone NAPSA/1238 + NAPSA/1239, Unconjugated-100ug

9476-MSM4-P1 100ug
EUR 428

Napsin A (Lung Adenocarcinoma Marker); Clones NAPSA/1238 & NAPSA/1239 (Concentrate)

RA0479-C.1 0.1 ml
EUR 125

Napsin A (Lung Adenocarcinoma Marker); Clones NAPSA/1238 & NAPSA/1239 (Concentrate)

RA0479-C.5 0.5 ml
EUR 300

Napsin A (Lung Adenocarcinoma Marker); Clones NAPSA/1238 & NAPSA/1239 (Concentrate)

RA0479-C1 1 ml
EUR 500

Monoclonal Napsin A (Lung Adenocarcinoma Marker) Antibody, Clone: NAPSA/1238 + NAPSA/1239

AMM01566G 7 ml
EUR 484
Description: A Monoclonal antibody against Human Napsin A (Lung Adenocarcinoma Marker). The antibodies are raised in Mouse and are from clone NAPSA/1238 + NAPSA/1239. This antibody is applicable in WB, IHC and IF, FC

Polyclonal NAPSA antibody - middle region

APR01591G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAPSA - middle region. This antibody is tested and proven to work in the following applications:

Monoclonal NAPSA Antibody, Clone: 10C4B8

APR08607G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NAPSA. The antibodies are raised in Mouse and are from clone 10C4B8. This antibody is applicable in WB and IHC, E

Napsin-A(NAPSA/1238) Antibody

BNC551238-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1238), CF555 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC551238-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1238), CF555 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC551239-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1239), CF555 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC551239-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1239), CF555 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC611238-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1238), CF660R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC611238-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1238), CF660R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC611239-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1239), CF660R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC611239-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1239), CF660R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC401238-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1238), CF640R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC401238-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1238), CF640R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC401239-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1239), CF640R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC401239-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1239), CF640R conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC431238-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1238), CF543 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1238) Antibody

BNC431238-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1238), CF543 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC431239-100 100uL
EUR 199
Description: Primary antibody against Napsin-A(NAPSA/1239), CF543 conjugate, Concentration: 0.1mg/mL

Napsin-A(NAPSA/1239) Antibody

BNC431239-500 500uL
EUR 544
Description: Primary antibody against Napsin-A(NAPSA/1239), CF543 conjugate, Concentration: 0.1mg/mL