NAPA

NAPA siRNA
20-abx903468	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAPA siRNA
20-abx925400	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAPA siRNA
20-abx925401	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAPA antibody
10-N40A	Fitzgerald	500 ug	EUR 489
Description: Mouse monoclonal NAPA antibody

NAPA Antibody
31126-100ul	SAB	100ul	EUR 252

NAPA Antibody
31126-50ul	SAB	50ul	EUR 187

NAPA antibody
20R-1339	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NAPA antibody

NAPA antibody
70R-18750	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NAPA antibody

NAPA Antibody
1-CSB-PA253076	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAPA Antibody
1-CSB-PA121487	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

NAPA Antibody
1-CSB-PA015447GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NAPA Antibody
1-CSB-PA015447LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

NAPA Conjugated Antibody
C31126	SAB	100ul	EUR 397

NAPA cloning plasmid
CSB-CL015447HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 888 Sequence: atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggag Show more
Description: A cloning plasmid for the NAPA gene.

NAPA Polyclonal Antibody
A59986	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NAPA Rabbit pAb
A7946-100ul	Abclonal	100 ul	EUR 308

NAPA Rabbit pAb
A7946-200ul	Abclonal	200 ul	EUR 459

NAPA Rabbit pAb
A7946-20ul	Abclonal	20 ul	EUR 183

NAPA Rabbit pAb
A7946-50ul	Abclonal	50 ul	EUR 223

NAPA Blocking Peptide
33R-5853	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPA antibody, catalog no. 20R-1339

Anti-NAPA Antibody
STJ503074	St John's Laboratory	100 µg	EUR 476

Anti-NAPA antibody
STJ110255	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene.

Mouse NAPA shRNA Plasmid
20-abx979896	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NAPA shRNA Plasmid
20-abx987517	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NAPA shRNA Plasmid
20-abx955780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAPA protein (His tag)
80R-1470	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human NAPA protein

Borrelia NapA (80.0%) [His]
DAGA-467	Creative Diagnostics	5ug	EUR 502

NAPA Antibody, HRP conjugated
1-CSB-PA015447LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAPA Antibody, FITC conjugated
1-CSB-PA015447LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAPA Antibody, Biotin conjugated
1-CSB-PA015447LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAPA Recombinant Protein (Human)
RP020665	ABM	100 ug	Ask for price

NAPA Recombinant Protein (Rat)
RP213263	ABM	100 ug	Ask for price

pCMV-SPORT6-NAPA Plasmid
PVT16624	Lifescience Market	2 ug	EUR 325

NAPA Recombinant Protein (Mouse)
RP153074	ABM	100 ug	Ask for price

Anti-NAPA Antibody (Biotin)
STJ503075	St John's Laboratory	100 µg	EUR 586

Anti-NAPA Antibody (FITC)
STJ503076	St John's Laboratory	100 µg	EUR 586

NAPA Polyclonal Antibody, Biotin Conjugated
A59987	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NAPA Polyclonal Antibody, FITC Conjugated
A59988	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NAPA Polyclonal Antibody, HRP Conjugated
A59989	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Human SNAP-alpha (NAPA) Antibody
30178-05111	AssayPro	150 ug	EUR 261

NAPA ORF Vector (Human) (pORF)
ORF006889	ABM	1.0 ug DNA	EUR 95

Napa ORF Vector (Rat) (pORF)
ORF071089	ABM	1.0 ug DNA	EUR 506

Napa ORF Vector (Mouse) (pORF)
ORF051026	ABM	1.0 ug DNA	EUR 506

Recombinant Aeromonas Hydrophila napA Protein
VAng-Lsx0847-inquire	Creative Biolabs	inquire	Ask for price
Description: Aeromonas Hydrophila Periplasmic nitrate reductase, recombinant protein.

Recombinant Aeromonas Salmonicida napA Protein
VAng-Lsx1209-inquire	Creative Biolabs	inquire	Ask for price
Description: Aeromonas Salmonicida Periplasmic nitrate reductase, recombinant protein.

Recombinant Borrelia Burgdorferi NapA Protein
VAng-Lsx1729-1mg	Creative Biolabs	1 mg	EUR 9738
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

Recombinant Borrelia Burgdorferi NapA Protein
VAng-Lsx1729-20g	Creative Biolabs	20 µg	EUR 612
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

Recombinant Borrelia Burgdorferi NapA Protein
VAng-Lsx1729-5g	Creative Biolabs	5 µg	EUR 436
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

NAPA sgRNA CRISPR Lentivector set (Human)
K1390401	ABM	3 x 1.0 ug	EUR 339

Napa sgRNA CRISPR Lentivector set (Mouse)
K3558401	ABM	3 x 1.0 ug	EUR 339

Napa sgRNA CRISPR Lentivector set (Rat)
K6956501	ABM	3 x 1.0 ug	EUR 339

Human SNAP-alpha (NAPA) Antibody (Biotin Conjugate)
30178-05121	AssayPro	150 ug	EUR 369

NAPA sgRNA CRISPR Lentivector (Human) (Target 1)
K1390402	ABM	1.0 ug DNA	EUR 154

NAPA sgRNA CRISPR Lentivector (Human) (Target 2)
K1390403	ABM	1.0 ug DNA	EUR 154

NAPA sgRNA CRISPR Lentivector (Human) (Target 3)
K1390404	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3558402	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3558403	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3558404	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Rat) (Target 1)
K6956502	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Rat) (Target 2)
K6956503	ABM	1.0 ug DNA	EUR 154

Napa sgRNA CRISPR Lentivector (Rat) (Target 3)
K6956504	ABM	1.0 ug DNA	EUR 154

Recombinant Human NAPA Protein, His, E.coli-1mg
QP12793-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human NAPA Protein, His, E.coli-20ug
QP12793-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human NAPA Protein, His, E.coli-5ug
QP12793-5ug	EnQuireBio	5ug	EUR 155

NAPA Protein Vector (Rat) (pPB-C-His)
PV284354	ABM	500 ng	EUR 603

NAPA Protein Vector (Rat) (pPB-N-His)
PV284355	ABM	500 ng	EUR 603

NAPA Protein Vector (Rat) (pPM-C-HA)
PV284356	ABM	500 ng	EUR 603

NAPA Protein Vector (Rat) (pPM-C-His)
PV284357	ABM	500 ng	EUR 603

NAPA Protein Vector (Human) (pPB-C-His)
PV027553	ABM	500 ng	EUR 329

NAPA Protein Vector (Human) (pPB-N-His)
PV027554	ABM	500 ng	EUR 329

NAPA Protein Vector (Human) (pPM-C-HA)
PV027555	ABM	500 ng	EUR 329

NAPA Protein Vector (Human) (pPM-C-His)
PV027556	ABM	500 ng	EUR 329

NAPA Protein Vector (Mouse) (pPB-C-His)
PV204102	ABM	500 ng	EUR 603

NAPA Protein Vector (Mouse) (pPB-N-His)
PV204103	ABM	500 ng	EUR 603

NAPA Protein Vector (Mouse) (pPM-C-HA)
PV204104	ABM	500 ng	EUR 603

NAPA Protein Vector (Mouse) (pPM-C-His)
PV204105	ABM	500 ng	EUR 603

Napa 3'UTR GFP Stable Cell Line
TU163835	ABM	1.0 ml	Ask for price

Napa 3'UTR Luciferase Stable Cell Line
TU213741	ABM	1.0 ml	Ask for price

NAPA 3'UTR Luciferase Stable Cell Line
TU015224	ABM	1.0 ml	EUR 1394

Napa 3'UTR Luciferase Stable Cell Line
TU113835	ABM	1.0 ml	Ask for price

NAPA 3'UTR GFP Stable Cell Line
TU065224	ABM	1.0 ml	EUR 1394

Napa 3'UTR GFP Stable Cell Line
TU263741	ABM	1.0 ml	Ask for price

Human SNAP-alpha (NAPA) AssayLite Antibody (FITC Conjugate)
30178-05141	AssayPro	150 ug	EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (RPE Conjugate)
30178-05151	AssayPro	150 ug	EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (APC Conjugate)
30178-05161	AssayPro	150 ug	EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (PerCP Conjugate)
30178-05171	AssayPro	150 ug	EUR 471

NAPA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690067	ABM	1.0 ug DNA	EUR 514

NAPA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690071	ABM	1.0 ug DNA	EUR 514

NAPA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690072	ABM	1.0 ug DNA	EUR 514

Recombinant other Borrelia NapA Protein, His, E.coli-1mg
QP11188-1mg	EnQuireBio	1mg	EUR 3655

Recombinant other Borrelia NapA Protein, His, E.coli-20ug
QP11188-20ug	EnQuireBio	20ug	EUR 201

Recombinant other Borrelia NapA Protein, His, E.coli-5ug
QP11188-5ug	EnQuireBio	5ug	EUR 155

Recombinant Pasteurella Multocida napA Protein (aa 1-828)
VAng-Cr7005-inquire	Creative Biolabs	inquire	Ask for price
Description: Pasteurella Multocida (strain Pm70) Periplasmic nitrate reductase (napA), recombinant protein.

Recombinant Pseudomonas Aeruginosa napA Protein (aa 1-834)
VAng-Cr0060-inquire	Creative Biolabs	inquire	Ask for price
Description: Pseudomonas Aeruginosa periplasmic nitrate reductase (napA), recombinant protein.

Recombinant Shigella Flexneri napA Protein (aa 1-828)
VAng-Lsx07975-inquire	Creative Biolabs	inquire	Ask for price
Description: Shigella Flexneri Periplasmic nitrate reductase, recombinant protein.