MSRB3

MSRB3 Antibody
1-CSB-PA810290DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB3. Recognizes MSRB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB3 siRNA
20-abx924813	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSRB3 siRNA
20-abx924814	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSRB3 Polyclonal Antibody
31414-100ul	SAB	100ul	EUR 252

MSRB3 Polyclonal Antibody
31414-50ul	SAB	50ul	EUR 187

MSRB3 cloning plasmid
CSB-CL810290HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 558 Sequence: atgtctgcattcaacctgctgcatttggtgacaaagagccagccagtagcccttcgagcctgtgggcttccctcagggtcgtgtagggataaaaagaactgtaaggtggtcttttcccagcaggaactgaggaagcggctaacacccctgcagtaccatgtcactcaggagaaagg Show more
Description: A cloning plasmid for the MSRB3 gene.

MSRB3 Rabbit pAb
A8005-100ul	Abclonal	100 ul	EUR 308

MSRB3 Rabbit pAb
A8005-200ul	Abclonal	200 ul	EUR 459

MSRB3 Rabbit pAb
A8005-20ul	Abclonal	20 ul	EUR 183

MSRB3 Rabbit pAb
A8005-50ul	Abclonal	50 ul	EUR 223

anti- MSRB3 antibody
FNab05384	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IHC: 1:100-1:400 Immunogen: methionine sulfoxide reductase B3 Uniprot ID: Q8IXL7 Gene ID: 253827 Research Area: Metabolism
Description: Antibody raised against MSRB3

Anti-MSRB3 antibody
PAab05384	Lifescience Market	100 ug	EUR 355

Anti-MSRB3 antibody
STJ110312	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula.

MSRB3 protein (His tag)
80R-1709	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human MSRB3 protein

Mouse Msrb3 ELISA KIT
ELI-19349m	Lifescience Market	96 Tests	EUR 865

MSRB3 ELISA KIT|Human
EF000963	Lifescience Market	96 Tests	EUR 689

Human MSRB3 shRNA Plasmid
20-abx966654	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MSRB3 Polyclonal Conjugated Antibody
C31414	SAB	100ul	EUR 397

Mouse MSRB3 shRNA Plasmid
20-abx983365	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-MSRB3 Plasmid
PVT16880	Lifescience Market	2 ug	EUR 325

MSRB3 Recombinant Protein (Human)
RP020188	ABM	100 ug	Ask for price

MSRB3 Recombinant Protein (Mouse)
RP151868	ABM	100 ug	Ask for price

MSRB3 ORF Vector (Human) (pORF)
ORF006730	ABM	1.0 ug DNA	EUR 95

Msrb3 ORF Vector (Mouse) (pORF)
ORF050624	ABM	1.0 ug DNA	EUR 506

MSRB3 ELISA Kit (Human) (OKCA01358)
OKCA01358	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Catalyzes the reduction of free and protein-bound methionine sulfoxide to methionine. Isoform 2 is essential for hearing.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Msrb3 sgRNA CRISPR Lentivector set (Mouse)
K3627101	ABM	3 x 1.0 ug	EUR 339

MSRB3 sgRNA CRISPR Lentivector set (Human)
K1350701	ABM	3 x 1.0 ug	EUR 339

Human Methionine-R-sulfoxide reductase B3 (MSRB3)
1-CSB-EP810290HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 47 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Methionine-R-sulfoxide reductase B3(MSRB3) expressed in E.coli

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody
20-abx006684	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody
20-abx141552	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody
abx235384-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody
20-abx322550	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody
20-abx322551	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3627102	ABM	1.0 ug DNA	EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3627103	ABM	1.0 ug DNA	EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3627104	ABM	1.0 ug DNA	EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1350702	ABM	1.0 ug DNA	EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1350703	ABM	1.0 ug DNA	EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1350704	ABM	1.0 ug DNA	EUR 154

MSRB3 Protein Vector (Mouse) (pPB-C-His)
PV202494	ABM	500 ng	EUR 1065

MSRB3 Protein Vector (Mouse) (pPB-N-His)
PV202495	ABM	500 ng	EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-HA)
PV202496	ABM	500 ng	EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-His)
PV202497	ABM	500 ng	EUR 1065

MSRB3 Protein Vector (Human) (pPB-C-His)
PV026917	ABM	500 ng	EUR 329

MSRB3 Protein Vector (Human) (pPB-N-His)
PV026918	ABM	500 ng	EUR 329

MSRB3 Protein Vector (Human) (pPM-C-HA)
PV026919	ABM	500 ng	EUR 329

MSRB3 Protein Vector (Human) (pPM-C-His)
PV026920	ABM	500 ng	EUR 329

Recombinant Human MSRB3 Protein, GST, E.coli-100ug
QP7810-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human MSRB3 Protein, GST, E.coli-10ug
QP7810-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human MSRB3 Protein, GST, E.coli-1mg
QP7810-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human MSRB3 Protein, GST, E.coli-200ug
QP7810-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human MSRB3 Protein, GST, E.coli-500ug
QP7810-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human MSRB3 Protein, GST, E.coli-50ug
QP7810-ec-50ug	EnQuireBio	50ug	EUR 263

Msrb3 3'UTR Luciferase Stable Cell Line
TU113533	ABM	1.0 ml	Ask for price

Msrb3 3'UTR GFP Stable Cell Line
TU163533	ABM	1.0 ml	Ask for price

MSRB3 3'UTR GFP Stable Cell Line
TU064779	ABM	1.0 ml	EUR 2333

MSRB3 3'UTR Luciferase Stable Cell Line
TU014779	ABM	1.0 ml	EUR 2333

MSRB3 Methionine Sulfoxide Reductase B3 Human Recombinant Protein
PROTQ8IXL7	BosterBio	Regular: 10ug	EUR 317
Description: MSRB3 Human Recombinant fused with an 8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 174 amino acids (21-185 a.a.) and having a molecular mass of 19kDa. The MSRB3 is purified by proprietary chromatographic techniques.

Human Methionine- R- sulfoxide reductase B3, MSRB3 ELISA KIT
ELI-14242h	Lifescience Market	96 Tests	EUR 824

Mouse Methionine-R-sulfoxide reductase B3 (MSRB3) ELISA Kit
abx389867-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Msrb3 ELISA Kit| Mouse Methionine-R-sulfoxide reductase B3 ELIS
EF015503	Lifescience Market	96 Tests	EUR 689

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3627105	ABM	3 x 1.0 ug	EUR 376

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1350705	ABM	3 x 1.0 ug	EUR 376

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3627106	ABM	1.0 ug DNA	EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3627107	ABM	1.0 ug DNA	EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3627108	ABM	1.0 ug DNA	EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1350706	ABM	1.0 ug DNA	EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1350707	ABM	1.0 ug DNA	EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1350708	ABM	1.0 ug DNA	EUR 167