  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB3. Recognizes MSRB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

MSRB3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB3. Recognizes MSRB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti- MSRB3 antibody

FNab05384 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:100-1:400
  • Immunogen: methionine sulfoxide reductase B3
  • Uniprot ID: Q8IXL7
  • Gene ID: 253827
  • Research Area: Metabolism
Description: Antibody raised against MSRB3

MSRB3 Rabbit pAb

A8005-100ul 100 ul
EUR 308

MSRB3 Rabbit pAb

A8005-200ul 200 ul
EUR 459

MSRB3 Rabbit pAb

A8005-20ul 20 ul
EUR 183

MSRB3 Rabbit pAb

A8005-50ul 50 ul
EUR 223

MSRB3 Polyclonal Antibody

31414-100ul 100ul
EUR 252

MSRB3 Polyclonal Antibody

31414-50ul 50ul
EUR 187

MSRB3 cloning plasmid

CSB-CL810290HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 558
  • Sequence: atgtctgcattcaacctgctgcatttggtgacaaagagccagccagtagcccttcgagcctgtgggcttccctcagggtcgtgtagggataaaaagaactgtaaggtggtcttttcccagcaggaactgaggaagcggctaacacccctgcagtaccatgtcactcaggagaaagg
  • Show more
Description: A cloning plasmid for the MSRB3 gene.

Anti-MSRB3 antibody

PAab05384 100 ug
EUR 355

Anti-MSRB3 antibody

STJ110312 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula.

MSRB3 Polyclonal Conjugated Antibody

C31414 100ul
EUR 397

Mouse MSRB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Msrb3 ELISA KIT

ELI-19349m 96 Tests
EUR 865


EF000963 96 Tests
EUR 689

MSRB3 protein (His tag)

80R-1709 50 ug
EUR 397
Description: Purified recombinant Human MSRB3 protein

Human MSRB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSRB3 Recombinant Protein (Human)

RP020188 100 ug Ask for price


PVT16880 2 ug
EUR 325

MSRB3 Recombinant Protein (Mouse)

RP151868 100 ug Ask for price

MSRB3 ORF Vector (Human) (pORF)

ORF006730 1.0 ug DNA
EUR 95

Msrb3 ORF Vector (Mouse) (pORF)

ORF050624 1.0 ug DNA
EUR 506

MSRB3 ELISA Kit (Human) (OKCA01358)

OKCA01358 96 Wells
EUR 846
Description: Description of target: Catalyzes the reduction of free and protein-bound methionine sulfoxide to methionine. Isoform 2 is essential for hearing.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Msrb3 sgRNA CRISPR Lentivector set (Mouse)

K3627101 3 x 1.0 ug
EUR 339

MSRB3 sgRNA CRISPR Lentivector set (Human)

K1350701 3 x 1.0 ug
EUR 339

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

abx235384-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3627102 1.0 ug DNA
EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3627103 1.0 ug DNA
EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3627104 1.0 ug DNA
EUR 154

Human Methionine-R-sulfoxide reductase B3 (MSRB3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Methionine-R-sulfoxide reductase B3(MSRB3) expressed in E.coli

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1350702 1.0 ug DNA
EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1350703 1.0 ug DNA
EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1350704 1.0 ug DNA
EUR 154

Recombinant Human MSRB3 Protein, GST, E.coli-100ug

QP7810-ec-100ug 100ug
EUR 408

Recombinant Human MSRB3 Protein, GST, E.coli-10ug

QP7810-ec-10ug 10ug
EUR 200

Recombinant Human MSRB3 Protein, GST, E.coli-1mg

QP7810-ec-1mg 1mg
EUR 1632

Recombinant Human MSRB3 Protein, GST, E.coli-200ug

QP7810-ec-200ug 200ug
EUR 634

Recombinant Human MSRB3 Protein, GST, E.coli-500ug

QP7810-ec-500ug 500ug
EUR 1060

Recombinant Human MSRB3 Protein, GST, E.coli-50ug

QP7810-ec-50ug 50ug
EUR 263

MSRB3 Protein Vector (Human) (pPB-C-His)

PV026917 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPB-N-His)

PV026918 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPM-C-HA)

PV026919 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPM-C-His)

PV026920 500 ng
EUR 329

MSRB3 Protein Vector (Mouse) (pPB-C-His)

PV202494 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPB-N-His)

PV202495 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-HA)

PV202496 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-His)

PV202497 500 ng
EUR 1065

Msrb3 3'UTR GFP Stable Cell Line

TU163533 1.0 ml Ask for price

MSRB3 3'UTR Luciferase Stable Cell Line

TU014779 1.0 ml
EUR 2333

Msrb3 3'UTR Luciferase Stable Cell Line

TU113533 1.0 ml Ask for price

MSRB3 3'UTR GFP Stable Cell Line

TU064779 1.0 ml
EUR 2333

MSRB3 Methionine Sulfoxide Reductase B3 Human Recombinant Protein

PROTQ8IXL7 Regular: 10ug
EUR 317
Description: MSRB3 Human Recombinant fused with an 8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 174 amino acids (21-185 a.a.) and having a molecular mass of 19kDa. The MSRB3 is purified by proprietary chromatographic techniques.

Human Methionine- R- sulfoxide reductase B3, MSRB3 ELISA KIT

ELI-14242h 96 Tests
EUR 824

Mouse Methionine-R-sulfoxide reductase B3 (MSRB3) ELISA Kit

abx389867-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msrb3 ELISA Kit| Mouse Methionine-R-sulfoxide reductase B3 ELIS

EF015503 96 Tests
EUR 689

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3627105 3 x 1.0 ug
EUR 376

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1350705 3 x 1.0 ug
EUR 376

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3627106 1.0 ug DNA
EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3627107 1.0 ug DNA
EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3627108 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1350706 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1350707 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1350708 1.0 ug DNA
EUR 167