
MDFI Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MDFI. Recognizes MDFI from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MDFI Antibody

DF4193 200ul
EUR 304
Description: MDFI Antibody detects endogenous levels of total MDFI.

MDFI antibody

70R-36982 100 ug
EUR 327
Description: Rabbit Polyclonal MDFI antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MDFI Antibody

ABD4193 100 ug
EUR 438


YF-PA24134 50 ul
EUR 334
Description: Mouse polyclonal to MDFI

Anti-MDFI Antibody

A10664-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MDFI Antibody (MDFI) detection. Tested with WB in Human, Mouse.

MDFI Rabbit pAb

A13709-100ul 100 ul
EUR 308

MDFI Rabbit pAb

A13709-200ul 200 ul
EUR 459

MDFI Rabbit pAb

A13709-20ul 20 ul
EUR 183

MDFI Rabbit pAb

A13709-50ul 50 ul
EUR 223

MDFI Blocking Peptide

DF4193-BP 1mg
EUR 195

MDFI Conjugated Antibody

C47720 100ul
EUR 397

MDFI cloning plasmid

CSB-CL013617HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgtaccaggtgagcggccagcgcccctctggctgcgacgcgccctatggagcccccagcgcagccccgggcccagcccagaccctatccctccttcctgggctggaggtagtaacaggatccactcaccctgcggaggcagcaccagaggagggctccctggaggaggcggcaac
  • Show more
Description: A cloning plasmid for the MDFI gene.

MDFI Polyclonal Antibody

ABP51764-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody

ABP51764-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody

ABP51764-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody

ES2763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MDFI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MDFI Polyclonal Antibody

ES2763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MDFI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MDFI antibody

STJ115663 100 µl
EUR 277
Description: This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures.

Anti-MDFI antibody

STJ94053 200 µl
EUR 197
Description: Rabbit polyclonal to MDFI.

Anti-MDFI antibody

STJ71955 100 µg
EUR 359

Anti-MDFI antibody

STJ72203 100 µg
EUR 260

Anti-MDFI (3B4)

YF-MA14162 100 ug
EUR 363
Description: Mouse monoclonal to MDFI

Human MDFI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MDFI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MDFI Recombinant Protein (Human)

RP019036 100 ug Ask for price

MDFI Recombinant Protein (Mouse)

RP149903 100 ug Ask for price

MDFI Recombinant Protein (Mouse)

RP149906 100 ug Ask for price

MDFI Recombinant Protein (Rat)

RP211190 100 ug Ask for price

Polyclonal MDFI Antibody (internal region)

APG00602G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MDFI Antibody (N-Term)

APG00665G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI (N-Term). This antibody is tested and proven to work in the following applications:

MyoD Family Inhibitor (MDFI) Antibody

abx216226-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MyoD Family Inhibitor (MDFI) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MyoD Family Inhibitor (MDFI) Antibody

abx432954-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

MyoD Family Inhibitor (MDFI) Antibody

abx432955-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Mdfi ORF Vector (Rat) (pORF)

ORF070398 1.0 ug DNA
EUR 506

MDFI ORF Vector (Human) (pORF)

ORF006346 1.0 ug DNA
EUR 95

Mdfi ORF Vector (Mouse) (pORF)

ORF049969 1.0 ug DNA
EUR 506

Mdfi ORF Vector (Mouse) (pORF)

ORF049970 1.0 ug DNA
EUR 506

Polyclonal MDFI / I-MF Antibody (Internal)

APG01239G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI / I-MF (Internal). This antibody is tested and proven to work in the following applications:

Mdfi sgRNA CRISPR Lentivector set (Mouse)

K4986601 3 x 1.0 ug
EUR 339

Mdfi sgRNA CRISPR Lentivector set (Rat)

K6679601 3 x 1.0 ug
EUR 339

MDFI sgRNA CRISPR Lentivector set (Human)

K1282601 3 x 1.0 ug
EUR 339

Mouse MyoD family inhibitor, Mdfi ELISA KIT

ELI-20464m 96 Tests
EUR 865

Human MyoD family inhibitor, MDFI ELISA KIT

ELI-46069h 96 Tests
EUR 824

Monoclonal MDFI Antibody (monoclonal) (M07), Clone: 3B4

AMM03785G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MDFI (monoclonal) (M07). The antibodies are raised in mouse and are from clone 3B4. This antibody is applicable in WB and IF

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4986602 1.0 ug DNA
EUR 154

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4986603 1.0 ug DNA
EUR 154

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4986604 1.0 ug DNA
EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 1)

K6679602 1.0 ug DNA
EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 2)

K6679603 1.0 ug DNA
EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 3)

K6679604 1.0 ug DNA
EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 1)

K1282602 1.0 ug DNA
EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 2)

K1282603 1.0 ug DNA
EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 3)

K1282604 1.0 ug DNA
EUR 154

MDFI Protein Vector (Rat) (pPB-C-His)

PV281590 500 ng
EUR 603

MDFI Protein Vector (Rat) (pPB-N-His)

PV281591 500 ng
EUR 603

MDFI Protein Vector (Rat) (pPM-C-HA)

PV281592 500 ng
EUR 603

MDFI Protein Vector (Rat) (pPM-C-His)

PV281593 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPB-C-His)

PV199874 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPB-N-His)

PV199875 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPM-C-HA)

PV199876 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPM-C-His)

PV199877 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPB-C-His)

PV199878 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPB-N-His)

PV199879 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPM-C-HA)

PV199880 500 ng
EUR 603

MDFI Protein Vector (Mouse) (pPM-C-His)

PV199881 500 ng
EUR 603

MDFI Protein Vector (Human) (pPB-C-His)

PV025381 500 ng
EUR 329

MDFI Protein Vector (Human) (pPB-N-His)

PV025382 500 ng
EUR 329

MDFI Protein Vector (Human) (pPM-C-HA)

PV025383 500 ng
EUR 329

MDFI Protein Vector (Human) (pPM-C-His)

PV025384 500 ng
EUR 329

Mdfi 3'UTR Luciferase Stable Cell Line

TU113020 1.0 ml Ask for price

Mdfi 3'UTR GFP Stable Cell Line

TU163020 1.0 ml Ask for price

Mdfi 3'UTR Luciferase Stable Cell Line

TU212992 1.0 ml Ask for price

Mdfi 3'UTR GFP Stable Cell Line

TU262992 1.0 ml Ask for price

MDFI 3'UTR GFP Stable Cell Line

TU063146 1.0 ml
EUR 1394

MDFI 3'UTR Luciferase Stable Cell Line

TU013146 1.0 ml
EUR 1394

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622663 1.0 ug DNA
EUR 514

MDFI Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622667 1.0 ug DNA
EUR 514

MDFI Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622668 1.0 ug DNA
EUR 514

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4986605 3 x 1.0 ug
EUR 376

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6679605 3 x 1.0 ug
EUR 376

MDFI sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1282605 3 x 1.0 ug
EUR 376

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4986606 1.0 ug DNA
EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4986607 1.0 ug DNA
EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4986608 1.0 ug DNA
EUR 167

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV622664 1.0 ug DNA
EUR 514

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV622665 1.0 ug DNA
EUR 572

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV622666 1.0 ug DNA
EUR 572

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6679606 1.0 ug DNA
EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6679607 1.0 ug DNA
EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6679608 1.0 ug DNA
EUR 167

MDFI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1282606 1.0 ug DNA
EUR 167