mbp sequence

Human Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Hu-96T 96T
EUR 621
  • Should the Human Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Mu-48T 48T
EUR 489
  • Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Mu-96T 96T
EUR 635
  • Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Rb-48T 48T
EUR 508
  • Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Rb-96T 96T
EUR 661
  • Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Human Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Hu-48Tests 48 Tests
EUR 478

Human Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Hu-96Tests 96 Tests
EUR 662

Mouse Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Mu-48Tests 48 Tests
EUR 489

Mouse Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Mu-96Tests 96 Tests
EUR 677

Rat Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Ra-96Tests 96 Tests
EUR 709

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Rb-48Tests 48 Tests
EUR 511

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Rb-96Tests 96 Tests
EUR 709

Human Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Hu-48Tests 48 Tests
EUR 500

Human Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Hu-96Tests 96 Tests
EUR 692

Mouse Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Mu-48Tests 48 Tests
EUR 511

Mouse Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Mu-96Tests 96 Tests
EUR 709

Rat Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Ra-96Tests 96 Tests
EUR 742

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Rb-48Tests 48 Tests
EUR 534

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Rb-96Tests 96 Tests
EUR 742

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-100-MBP 1 Kit
EUR 712

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-105-MBP 1 Kit
EUR 712

Rat Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative

630-110-MBP 1 Kit
EUR 712

Rat Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-115-MBP 1 Kit
EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative

630-120-MBP 1 Kit
EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-125-MBP 1 Kit
EUR 712

Human Anti-Myelin Basic Protein (MBP) IgGs ELISA Kit, 96 tests, Quantitative

630-130-MBP 1 Kit
EUR 712

Human Anti-Myelin Basic Protein (MBP) IgM ELISA Kit, 96 tests, Quantitative

630-135-MBP 1 Kit
EUR 712

C5a Inhibitory Sequence

H-8135.0005 5.0mg
EUR 708
Description: Sum Formula: C51H86N12O9; CAS# [133214-60-5]

C5a Inhibitory Sequence

H-8135.0025 25.0mg
EUR 2739
Description: Sum Formula: C51H86N12O9; CAS# [133214-60-5]

Anantin (linear sequence)

H-8140.0001 1.0mg
EUR 576
Description: Sum Formula: C90H113N21O25; CAS# [348600-37-3] net

Anantin (linear sequence)

H-8140.0005 5.0mg
EUR 2207
Description: Sum Formula: C90H113N21O25; CAS# [348600-37-3] net

Anantin (linear sequence)

5-00672 4 x 1mg Ask for price


ELA-E0539r 96 Tests
EUR 886


ELA-E1650r 96 Tests
EUR 886

a2b1 Integrin Recognition Sequence

H-1376.0025 25.0mg
EUR 576
Description: Sum Formula: C14H22N4O9; CAS# [134580-64-6]

a2b1 Integrin Recognition Sequence

H-1376.0100 100.0mg
EUR 1663
Description: Sum Formula: C14H22N4O9; CAS# [134580-64-6]

LL - 37, reverse sequence

5-01471 4 x 1mg Ask for price

Substance P reversed sequence

5-01970 4 x 5mg Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBP Antibody

BF0621 200ul
EUR 376
Description: MBP antibody detects endogenous levels of total MBP.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBP antibody

70R-2324 50 ug
EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody

70R-2325 50 ug
EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody

70R-MR055 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP Antibody

ABD6539 100 ug
EUR 438

MBP antibody

10R-10450 100 ug
EUR 435
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-1051 100 ul
EUR 316
Description: Mouse monoclonal MBP antibody

MBP antibody

10-M59A 1 mg
EUR 620
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-M162AP 200 ug
EUR 775
Description: Mouse monoclonal MBP antibody

MBP protein

30R-1158 0.5 mg
EUR 214
Description: Purified recombinant E.coli MBP protein

MBP protein

30R-AM030 1 mg
EUR 300
Description: Purified native Human MBP protein

MBP Antibody

32374-100ul 100ul
EUR 252

MBP antibody

10R-2151 100 ul
EUR 403
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-3101 100 ug
EUR 407
Description: Mouse monoclonal GFP antibody

MBP antibody

20R-2750 50 ug
EUR 281
Description: Rabbit polyclonal MBP antibody

MBP antibody

20R-2860 100 ul
EUR 349
Description: Chicken polyclonal MBP antibody

MBP antibody

70R-18432 50 ul
EUR 435
Description: Rabbit polyclonal MBP antibody

MBP antibody

70R-13733 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP antibody

70R-10644 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal MBP antibody

MBP antibody

70R-10674 1 ml
EUR 373
Description: Rabbit polyclonal MBP antibody

MBP Antibody

DF6539 200ul
EUR 304
Description: MBP Antibody detects endogenous levels of total MBP.

MBP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MBP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

MBP Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

MBP Antibody

CSB-PA261629-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000


ELA-E0170r 96 Tests
EUR 886


ELA-E1480r 96 Tests
EUR 886

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0001 1.0mg
EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0005 5.0mg
EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Signal Sequence Receptor, alpha Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Signal Sequence Receptor, beta Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody

abx146091-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody

abx032970-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody

abx032970-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Substance P reversed sequence Peptide

  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody

abx235565-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ACES™ Signal Sequence Kit

0148-2 kit
EUR 311

Breast Carcinoma Amplified Sequence 2

PR27246 5 ug
EUR 318

MBP Blocking Peptide

BF0621-BP 1mg
EUR 195

MBP cloning plasmid

CSB-CL013551HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 594
  • Sequence: atgggaaaccacgcaggcaaacgagaattaaatgccgagaaggccagtacgaatagtgaaactaacagaggagaatctgaaaaaaagagaaacctgggtgaactttcacggacaacctcagaggacaacgaagtgttcggagaggcagatgcgaaccagaacaatgggacctcctc
  • Show more
Description: A cloning plasmid for the MBP gene.

MBP Polyclonal Antibody

ES8978-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MBP Polyclonal Antibody

ES8978-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MBP Polyclonal Antibody

ABP59233-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody

ABP59233-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody

ABP59233-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP-tag Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.