mbp sequence

Human Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Hu-96T	DL Develop	96T	EUR 621
Should the Human Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Rb-48T	DL Develop	48T	EUR 508
Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit
DLR-MBP-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Human Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rabbit Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit Myelin Basic Protein (MBP) ELISA Kit
RD-MBP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Rabbit Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 534

Rabbit Myelin Basic Protein (MBP) ELISA Kit
RDR-MBP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative
630-100-MBP	Alpha Diagnostics	1 Kit	EUR 712

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative
630-105-MBP	Alpha Diagnostics	1 Kit	EUR 712

Rat Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative
630-110-MBP	Alpha Diagnostics	1 Kit	EUR 712

Rat Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative
630-115-MBP	Alpha Diagnostics	1 Kit	EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative
630-120-MBP	Alpha Diagnostics	1 Kit	EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative
630-125-MBP	Alpha Diagnostics	1 Kit	EUR 712

Human Anti-Myelin Basic Protein (MBP) IgGs ELISA Kit, 96 tests, Quantitative
630-130-MBP	Alpha Diagnostics	1 Kit	EUR 712

Human Anti-Myelin Basic Protein (MBP) IgM ELISA Kit, 96 tests, Quantitative
630-135-MBP	Alpha Diagnostics	1 Kit	EUR 712

C5a Inhibitory Sequence
H-8135.0005	Bachem	5.0mg	EUR 708
Description: Sum Formula: C51H86N12O9; CAS# [133214-60-5]

C5a Inhibitory Sequence
H-8135.0025	Bachem	25.0mg	EUR 2739
Description: Sum Formula: C51H86N12O9; CAS# [133214-60-5]

Anantin (linear sequence)
H-8140.0001	Bachem	1.0mg	EUR 576
Description: Sum Formula: C90H113N21O25; CAS# [348600-37-3] net

Anantin (linear sequence)
H-8140.0005	Bachem	5.0mg	EUR 2207
Description: Sum Formula: C90H113N21O25; CAS# [348600-37-3] net

Anantin (linear sequence)
5-00672	CHI Scientific	4 x 1mg	Ask for price

MBP/ Rat MBP ELISA Kit
ELA-E0539r	Lifescience Market	96 Tests	EUR 886

MBP/ Rat MBP ELISA Kit
ELA-E1650r	Lifescience Market	96 Tests	EUR 886

a2b1 Integrin Recognition Sequence
H-1376.0025	Bachem	25.0mg	EUR 576
Description: Sum Formula: C14H22N4O9; CAS# [134580-64-6]

a2b1 Integrin Recognition Sequence
H-1376.0100	Bachem	100.0mg	EUR 1663
Description: Sum Formula: C14H22N4O9; CAS# [134580-64-6]

LL - 37, reverse sequence
5-01471	CHI Scientific	4 x 1mg	Ask for price

Substance P reversed sequence
5-01970	CHI Scientific	4 x 5mg	Ask for price

MBP siRNA
20-abx903180	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MBP Antibody
BF0621	Affbiotech	200ul	EUR 376
Description: MBP antibody detects endogenous levels of total MBP.

MBP siRNA
20-abx923681	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MBP siRNA
20-abx923682	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MBP antibody
70R-2324	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody
70R-2325	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody
70R-MR055	Fitzgerald	100 ug	EUR 327
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP Antibody
ABD6539	Lifescience Market	100 ug	EUR 438

MBP antibody
10R-10450	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal MBP antibody

MBP antibody
10R-1051	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal MBP antibody

MBP antibody
10-M59A	Fitzgerald	1 mg	EUR 620
Description: Mouse monoclonal MBP antibody

MBP antibody
10R-M162AP	Fitzgerald	200 ug	EUR 775
Description: Mouse monoclonal MBP antibody

MBP protein
30R-1158	Fitzgerald	0.5 mg	EUR 214
Description: Purified recombinant E.coli MBP protein

MBP protein
30R-AM030	Fitzgerald	1 mg	EUR 300
Description: Purified native Human MBP protein

MBP Antibody
32374-100ul	SAB	100ul	EUR 252

MBP antibody
10R-2151	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal MBP antibody

MBP antibody
10R-3101	Fitzgerald	100 ug	EUR 407
Description: Mouse monoclonal GFP antibody

MBP antibody
20R-2750	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal MBP antibody

MBP antibody
20R-2860	Fitzgerald	100 ul	EUR 349
Description: Chicken polyclonal MBP antibody

MBP antibody
70R-18432	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MBP antibody

MBP antibody
70R-13733	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP antibody
70R-10644	Fitzgerald	1 ml	EUR 693
Description: Affinity purified Chicken polyclonal MBP antibody

MBP antibody
70R-10674	Fitzgerald	1 ml	EUR 373
Description: Rabbit polyclonal MBP antibody

MBP Antibody
DF6539	Affbiotech	200ul	EUR 304
Description: MBP Antibody detects endogenous levels of total MBP.

MBP Antibody
1-CSB-PA013551GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MBP Antibody
1-CSB-PA013551LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

MBP Antibody
CSB-PA261629-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

MBP Antibody
CSB-PA261629-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

MBP-Ab/ Rat MBP- Ab ELISA Kit
ELA-E0170r	Lifescience Market	96 Tests	EUR 886

MBP/MBL/ Rat MBP/ MBL ELISA Kit
ELA-E1480r	Lifescience Market	96 Tests	EUR 886

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0001	Bachem	1.0mg	EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0005	Bachem	5.0mg	EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Signal Sequence Receptor, alpha Antibody
20-abx115551	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody
20-abx114066	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Signal Sequence Receptor, beta Antibody
20-abx137475	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody
abx146091-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody
abx032970-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glioblastoma-Amplified Sequence (GBAS) Antibody
abx032970-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody
20-abx003586	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody
20-abx321319	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody
20-abx217051	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Substance P reversed sequence Peptide
20-abx266314	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Neuroblastoma Amplified Sequence (NBAS) Antibody
abx235565-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

ACES™ Signal Sequence Kit
0148-2	AthenaES	kit	EUR 311

Breast Carcinoma Amplified Sequence 2
PR27246	Neuromics	5 ug	EUR 318

MBP Blocking Peptide
BF0621-BP	Affbiotech	1mg	EUR 195

MBP cloning plasmid
CSB-CL013551HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 594 Sequence: atgggaaaccacgcaggcaaacgagaattaaatgccgagaaggccagtacgaatagtgaaactaacagaggagaatctgaaaaaaagagaaacctgggtgaactttcacggacaacctcagaggacaacgaagtgttcggagaggcagatgcgaaccagaacaatgggacctcctc Show more
Description: A cloning plasmid for the MBP gene.

MBP Polyclonal Antibody
ES8978-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MBP Polyclonal Antibody
ES8978-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MBP Polyclonal Antibody
ABP59233-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody
ABP59233-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody
ABP59233-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP-tag Antibody
20-abx134443	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.