INHBE

Bovine Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-b-96T	DL Develop	96T	EUR 715
Should the Bovine Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Hu-48T	DL Develop	48T	EUR 479
Should the Human Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Hu-96T	DL Develop	96T	EUR 621
Should the Human Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Inhibin Beta E (INHbE) ELISA Kit
DLR-INHbE-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Human Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Inhibin Beta E (INHbE) ELISA Kit
RDR-INHbE-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Bovine Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Human Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Inhibin Beta E (INHbE) ELISA Kit
RD-INHbE-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Inhbe/ Rat Inhbe ELISA Kit
ELI-43732r	Lifescience Market	96 Tests	EUR 886

INHBE Antibody
1-CSB-PA005410	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against INHBE. Recognizes INHBE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

INHBE siRNA
20-abx902685	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

INHBE siRNA
20-abx920621	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

INHBE siRNA
20-abx920622	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-INHBE
YF-PA21248	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to INHBE

anti-INHBE
YF-PA21249	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to INHBE

anti-INHBE
YF-PA21250	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to INHBE

anti-INHBE
YF-PA21251	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to INHBE

anti-INHBE
YF-PA21252	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to INHBE

INHBE cloning plasmid
CSB-CL011722HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1053 Sequence: atgcggctccctgatgtccagctctggctggtgctgctgtgggcactggtgcgagcacaggggacagggtctgtgtgtccctcctgtgggggctccaaactggcaccccaagcagaacgagctctggtgctggagctagccaagcagcaaatcctggatgggttgcacctgacca Show more
Description: A cloning plasmid for the INHBE gene.

Anti-INHBE (4B5)
YF-MA19478	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to INHBE

Rat INHBE shRNA Plasmid
20-abx986838	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human INHBE shRNA Plasmid
20-abx963178	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse INHBE shRNA Plasmid
20-abx971060	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

INHBE Recombinant Protein (Human)
RP016168	ABM	100 ug	Ask for price

INHBE Recombinant Protein (Rat)
RP206045	ABM	100 ug	Ask for price

INHBE Recombinant Protein (Mouse)
RP143852	ABM	100 ug	Ask for price

Inhibin Beta E (INHbE) Antibody
20-abx176937	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Inhibin Beta E (INHbE) Antibody
20-abx176938	Abbexa	EUR 1288.00 EUR 620.00	1 mg 200 ug
Please enquire.

Inhibin Beta E (INHbE) Antibody
20-abx101317	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Inhibin Beta E (INHbE) Antibody
20-abx101318	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Inhibin Beta E (INHbE) Antibody
20-abx129499	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Inhibin Beta E (INHBE) Antibody
20-abx141235	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Inhibin Beta E (INHbE) Antibody
20-abx172891	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Inhibin Beta E (INHbE) Antibody
20-abx172892	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Inhibin Beta E (INHBE) Antibody
20-abx327466	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Inhbe ORF Vector (Rat) (pORF)
ORF068683	ABM	1.0 ug DNA	EUR 506

INHBE ORF Vector (Human) (pORF)
ORF005390	ABM	1.0 ug DNA	EUR 95

Inhbe ORF Vector (Mouse) (pORF)
ORF047952	ABM	1.0 ug DNA	EUR 506

Recombinant Inhibin Beta E (INHbE)
4-RPA048Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P58166 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 13.7kDa Isoelectric Point: 6.2
Description: Recombinant Human Inhibin Beta E expressed in: E.coli

Recombinant Inhibin Beta E (INHbE)
4-RPA048Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O08717 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.6kDa Isoelectric Point: 8.1
Description: Recombinant Mouse Inhibin Beta E expressed in: E.coli

Recombinant Inhibin Beta E (INHbE)
4-RPA048Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88959 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.0kDa Isoelectric Point: 6
Description: Recombinant Rat Inhibin Beta E expressed in: E.coli

INHBE ELISA Kit (Human) (OKCD00128)
OKCD00128	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Inhibins and activins inhibit and activate, respectively, the secretion of follitropin by the pituitary gland. Inhibins/activins are involved in regulating a number of diverse functions such as hypothalamic and pituitary hormone secretion, gonadal hormone secretion, germ cell development and maturation, erythroid differentiation, insulin secretion, nerve cell survival, embryonic axial development or bone growth, depending on their subunit composition. Inhibins appear to oppose the functions of activins. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.7 pg/mL

INHBE ELISA Kit (Bovine) (OKCD04413)
OKCD04413	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Cattle;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.3 pg/mL

Mouse Inhibin Beta E (INHbE) Protein
20-abx168417	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Inhibin Beta E (INHbE) Protein
20-abx067205	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.