GNPNAT1

GNPNAT1 siRNA
20-abx918229	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNPNAT1 antibody
70R-17540	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNPNAT1 antibody

GNPNAT1 Antibody
DF13048	Affbiotech	200ul	EUR 304
Description: GNPNAT1 Antibody detects endogenous levels of GNPNAT1.

GNPNAT1 Antibody
1-CSB-PA856926LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

GNPNAT1 Antibody
1-CSB-PA009632GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-GNPNAT1
YF-PA26575	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GNPNAT1

anti- GNPNAT1 antibody
FNab03554	FN Test	100µg	EUR 505.25
Immunogen: glucosamine-phosphate N-acetyltransferase 1 Uniprot ID: Q96EK6 Gene ID: 64841 Research Area: Metabolism
Description: Antibody raised against GNPNAT1

GNPNAT1 Rabbit pAb
A17759-100ul	Abclonal	100 ul	EUR 308

GNPNAT1 Rabbit pAb
A17759-200ul	Abclonal	200 ul	EUR 459

GNPNAT1 Rabbit pAb
A17759-20ul	Abclonal	20 ul	EUR 183

GNPNAT1 Rabbit pAb
A17759-50ul	Abclonal	50 ul	EUR 223

GNPNAT1 Polyclonal Antibody
A67098	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNPNAT1 Polyclonal Antibody
30165-100ul	SAB	100ul	EUR 252

GNPNAT1 Polyclonal Antibody
30165-50ul	SAB	50ul	EUR 187

GNPNAT1 cloning plasmid
CSB-CL856926HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 555 Sequence: atgaaacctgatgaaactcctatgtttgacccaagtctactcaaagaagtggactggagtcagaatacagctacattttctccagccatttccccaacacatcctggagaaggcttggttttgaggcctctttgtactgctgacttaaatagaggtttttttaaggtattgggtca Show more
Description: A cloning plasmid for the GNPNAT1 gene.

GNPNAT1 Blocking Peptide
DF13048-BP	Affbiotech	1mg	EUR 195

Anti-GNPNAT1 antibody
PAab03554	Lifescience Market	100 ug	EUR 355

Anti-GNPNAT1 antibody
STJ119796	St John's Laboratory	100 µl	EUR 277

Anti-GNPNAT1 (1E9)
YF-MA19256	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GNPNAT1

GNPNAT1 Polyclonal Conjugated Antibody
C30165	SAB	100ul	EUR 397

Mouse GNPNAT1 shRNA Plasmid
20-abx974457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Gnpnat1 ELISA KIT
ELI-12708m	Lifescience Market	96 Tests	EUR 865

GNPNAT1 ELISA KIT|Human
EF009925	Lifescience Market	96 Tests	EUR 689

Human GNPNAT1 ELISA KIT
ELI-31792h	Lifescience Market	96 Tests	EUR 824

GNPNAT1 protein (His tag)
80R-1578	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human GNPNAT1 protein

Human GNPNAT1 shRNA Plasmid
20-abx962111	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNPNAT1 Antibody, HRP conjugated
1-CSB-PA856926LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNPNAT1 Antibody, FITC conjugated
1-CSB-PA856926LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNPNAT1 Antibody, Biotin conjugated
1-CSB-PA856926LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNPNAT1 Recombinant Protein (Human)
RP013597	ABM	100 ug	Ask for price

GNPNAT1 Recombinant Protein (Rat)
RP203066	ABM	100 ug	Ask for price

GNPNAT1 Recombinant Protein (Rat)
RP203069	ABM	100 ug	Ask for price

GNPNAT1 Recombinant Protein (Mouse)
RP139082	ABM	100 ug	Ask for price

GNPNAT1 Polyclonal Antibody, HRP Conjugated
A67099	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNPNAT1 Polyclonal Antibody, FITC Conjugated
A67100	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNPNAT1 Polyclonal Antibody, Biotin Conjugated
A67101	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNPNAT1 ORF Vector (Human) (pORF)
ORF004533	ABM	1.0 ug DNA	EUR 95

Gnpnat1 ORF Vector (Rat) (pORF)
ORF067690	ABM	1.0 ug DNA	EUR 506

Gnpnat1 ORF Vector (Rat) (pORF)
ORF067691	ABM	1.0 ug DNA	EUR 506

Gnpnat1 ORF Vector (Mouse) (pORF)
ORF046362	ABM	1.0 ug DNA	EUR 506

GNPNAT1 ELISA Kit (Human) (OKEH08314)
OKEH08314	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.101ng/mL

GNPNAT1 ELISA Kit (Mouse) (OKEH08315)
OKEH08315	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.265ng/mL

GNPNAT1 sgRNA CRISPR Lentivector set (Human)
K0879401	ABM	3 x 1.0 ug	EUR 339

Gnpnat1 sgRNA CRISPR Lentivector set (Mouse)
K4899101	ABM	3 x 1.0 ug	EUR 339

Gnpnat1 sgRNA CRISPR Lentivector set (Rat)
K6706901	ABM	3 x 1.0 ug	EUR 339

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0879402	ABM	1.0 ug DNA	EUR 154

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0879403	ABM	1.0 ug DNA	EUR 154

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0879404	ABM	1.0 ug DNA	EUR 154

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody
20-abx112731	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody
abx340083-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody
20-abx318119	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody
abx233554-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4899102	ABM	1.0 ug DNA	EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4899103	ABM	1.0 ug DNA	EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4899104	ABM	1.0 ug DNA	EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6706902	ABM	1.0 ug DNA	EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6706903	ABM	1.0 ug DNA	EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6706904	ABM	1.0 ug DNA	EUR 154

GNPNAT1 Protein Vector (Mouse) (pPB-C-His)
PV185446	ABM	500 ng	EUR 603

GNPNAT1 Protein Vector (Mouse) (pPB-N-His)
PV185447	ABM	500 ng	EUR 603