GNPNAT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

GNPNAT1 Antibody

DF13048 200ul
EUR 304
Description: GNPNAT1 Antibody detects endogenous levels of GNPNAT1.

GNPNAT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26575 50 ul
EUR 334
Description: Mouse polyclonal to GNPNAT1

GNPNAT1 Polyclonal Antibody

30165-100ul 100ul
EUR 252

GNPNAT1 Polyclonal Antibody

30165-50ul 50ul
EUR 187

GNPNAT1 Blocking Peptide

DF13048-BP 1mg
EUR 195

GNPNAT1 cloning plasmid

CSB-CL856926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgaaacctgatgaaactcctatgtttgacccaagtctactcaaagaagtggactggagtcagaatacagctacattttctccagccatttccccaacacatcctggagaaggcttggttttgaggcctctttgtactgctgacttaaatagaggtttttttaaggtattgggtca
  • Show more
Description: A cloning plasmid for the GNPNAT1 gene.

GNPNAT1 Polyclonal Antibody

A67098 100 µg
EUR 570.55
Description: fast delivery possible

GNPNAT1 Rabbit pAb

A17759-100ul 100 ul
EUR 308

GNPNAT1 Rabbit pAb

A17759-200ul 200 ul
EUR 459

GNPNAT1 Rabbit pAb

A17759-20ul 20 ul
EUR 183

GNPNAT1 Rabbit pAb

A17759-50ul 50 ul
EUR 223

anti- GNPNAT1 antibody

FNab03554 100µg
EUR 505.25
  • Immunogen: glucosamine-phosphate N-acetyltransferase 1
  • Uniprot ID: Q96EK6
  • Gene ID: 64841
  • Research Area: Metabolism
Description: Antibody raised against GNPNAT1

Anti-GNPNAT1 antibody

PAab03554 100 ug
EUR 355

Anti-GNPNAT1 antibody

STJ119796 100 µl
EUR 277

Anti-GNPNAT1 (1E9)

YF-MA19256 100 ug
EUR 363
Description: Mouse monoclonal to GNPNAT1

GNPNAT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNPNAT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNPNAT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNPNAT1. Recognizes GNPNAT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNPNAT1 protein (His tag)

80R-1578 50 ug
EUR 305
Description: Purified recombinant Human GNPNAT1 protein

Mouse Gnpnat1 ELISA KIT

ELI-12708m 96 Tests
EUR 865


EF009925 96 Tests
EUR 689

Mouse GNPNAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNPNAT1 Polyclonal Conjugated Antibody

C30165 100ul
EUR 397

Human GNPNAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-31792h 96 Tests
EUR 824

GNPNAT1 Recombinant Protein (Human)

RP013597 100 ug Ask for price

GNPNAT1 Recombinant Protein (Rat)

RP203066 100 ug Ask for price

GNPNAT1 Recombinant Protein (Rat)

RP203069 100 ug Ask for price

GNPNAT1 Recombinant Protein (Mouse)

RP139082 100 ug Ask for price

GNPNAT1 Polyclonal Antibody, HRP Conjugated

A67099 100 µg
EUR 570.55
Description: reagents widely cited

GNPNAT1 Polyclonal Antibody, FITC Conjugated

A67100 100 µg
EUR 570.55
Description: Ask the seller for details

GNPNAT1 Polyclonal Antibody, Biotin Conjugated

A67101 100 µg
EUR 570.55
Description: The best epigenetics products

Gnpnat1 ORF Vector (Rat) (pORF)

ORF067690 1.0 ug DNA
EUR 506

Gnpnat1 ORF Vector (Rat) (pORF)

ORF067691 1.0 ug DNA
EUR 506

GNPNAT1 ORF Vector (Human) (pORF)

ORF004533 1.0 ug DNA
EUR 95

Gnpnat1 ORF Vector (Mouse) (pORF)

ORF046362 1.0 ug DNA
EUR 506

GNPNAT1 ELISA Kit (Human) (OKEH08314)

OKEH08314 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.101ng/mL

GNPNAT1 ELISA Kit (Mouse) (OKEH08315)

OKEH08315 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.265ng/mL

Gnpnat1 sgRNA CRISPR Lentivector set (Mouse)

K4899101 3 x 1.0 ug
EUR 339

Gnpnat1 sgRNA CRISPR Lentivector set (Rat)

K6706901 3 x 1.0 ug
EUR 339

GNPNAT1 sgRNA CRISPR Lentivector set (Human)

K0879401 3 x 1.0 ug
EUR 339

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody

abx340083-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody

abx233554-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4899102 1.0 ug DNA
EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4899103 1.0 ug DNA
EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4899104 1.0 ug DNA
EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6706902 1.0 ug DNA
EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6706903 1.0 ug DNA
EUR 154

Gnpnat1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6706904 1.0 ug DNA
EUR 154

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0879402 1.0 ug DNA
EUR 154

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0879403 1.0 ug DNA
EUR 154

GNPNAT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0879404 1.0 ug DNA
EUR 154

GNPNAT1 Protein Vector (Rat) (pPB-C-His)

PV270758 500 ng
EUR 603

GNPNAT1 Protein Vector (Rat) (pPB-N-His)

PV270759 500 ng
EUR 603