Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit

DLR-GNaI3-Hu-96T 96T
EUR 673
  • Should the Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit

RDR-GNaI3-Hu-48Tests 48 Tests
EUR 544

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit

RDR-GNaI3-Hu-96Tests 96 Tests
EUR 756

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit

RD-GNaI3-Hu-48Tests 48 Tests
EUR 521

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit

RD-GNaI3-Hu-96Tests 96 Tests
EUR 723

Gnai3/ Rat Gnai3 ELISA Kit

ELI-38026r 96 Tests
EUR 886

GNAI3 antibody

70R-17521 50 ul
EUR 435
Description: Rabbit polyclonal GNAI3 antibody

GNAI3 Antibody

36493-100ul 100ul
EUR 252

GNAI3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAI3 Antibody

DF4107 200ul
EUR 304
Description: GNAI3 Antibody detects endogenous levels of total GNAI3.

GNAI3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAI3 antibody

70R-35506 100 ug
EUR 327
Description: Purified Rabbit polyclonal GNAI3 antibody

GNAI3 antibody

70R-9626 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GNAI3 antibody

GNAI3 antibody

70R-9627 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GNAI3 antibody

GNAI3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

GNAI3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAI3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI3 Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI3 Antibody

ABD4107 100 ug
EUR 438


YF-PA12056 50 ug
EUR 363
Description: Mouse polyclonal to GNAI3

GNAI3 Rabbit pAb

A15674-100ul 100 ul
EUR 308

GNAI3 Rabbit pAb

A15674-200ul 200 ul
EUR 459

GNAI3 Rabbit pAb

A15674-20ul 20 ul
EUR 183

GNAI3 Rabbit pAb

A15674-50ul 50 ul
EUR 223

GNAI3 Blocking Peptide

33R-2729 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI3 antibody, catalog no. 70R-9626

GNAI3 Blocking Peptide

33R-9315 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI3 antibody, catalog no. 70R-9627

GNAI3 Blocking Peptide

DF4107-BP 1mg
EUR 195

GNAI3 Conjugated Antibody

C36493 100ul
EUR 397

GNAI3 cloning plasmid

CSB-CL009591HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggctgcacgttgagcgccgaagacaaggcggcagtggagcgaagcaagatgatcgaccgcaacttacgggaggacggggaaaaagcggccaaagaagtgaagctgctgctactcggtgctggagaatctggtaaaagcaccattgtgaaacagatgaaaatcattcatgagg
  • Show more
Description: A cloning plasmid for the GNAI3 gene.

GNAI3 Polyclonal Antibody

A62666 100 µg
EUR 570.55
Description: The best epigenetics products

GNAI3 Rabbit pAb

A1922-100ul 100 ul
EUR 308

GNAI3 Rabbit pAb

A1922-200ul 200 ul
EUR 459

GNAI3 Rabbit pAb

A1922-20ul 20 ul
EUR 183

GNAI3 Rabbit pAb

A1922-50ul 50 ul
EUR 223

anti- GNAI3 antibody

FNab03533 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
  • Uniprot ID: P08754
  • Gene ID: 2773
  • Research Area: Signal Transduction
Description: Antibody raised against GNAI3

Anti-GNAI3 antibody

PAab03533 100 ug
EUR 355

Anti-GNAI3 antibody

STJ115271 100 µl
EUR 413
Description: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway.

Anti-GNAI3 antibody

STJ118134 100 µl
EUR 277

Anti-GNAI3 antibody

STJ29871 100 µl
EUR 277
Description: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway.

GNAI3 protein (His tag)

80R-2227 50 ug
EUR 322
Description: Purified recombinant Human GNAI3 Protein (His tag)

Mouse Gnai3 ELISA KIT

ELI-27930m 96 Tests
EUR 865


EF009908 96 Tests
EUR 689

Rat GNAI3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAI3 Polyclonal Conjugated Antibody

C27977 100ul
EUR 397

GNAI3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAI3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAI3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNAI3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAI3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-32692h 96 Tests
EUR 824

GNAI3 Recombinant Protein (Human)

RP013474 100 ug Ask for price

GNAI3 Recombinant Protein (Rat)

RP202949 100 ug Ask for price

GNAI3 Recombinant Protein (Mouse)

RP138902 100 ug Ask for price

[KO Validated] GNAI3 Polyclonal Antibody

27977-100ul 100ul
EUR 252

[KO Validated] GNAI3 Polyclonal Antibody

27977-50ul 50ul
EUR 187

[KO Validated] GNAI3 Rabbit pAb

A13307-100ul 100 ul
EUR 410

[KO Validated] GNAI3 Rabbit pAb

A13307-200ul 200 ul
EUR 571