GFPT2

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit
DLR-GFPT2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit
RD-GFPT2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit
RD-GFPT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit
RDR-GFPT2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit
RDR-GFPT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Gfpt2/ Rat Gfpt2 ELISA Kit
ELI-32629r	Lifescience Market	96 Tests	EUR 886

GFPT2 siRNA
20-abx902130	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFPT2 siRNA
20-abx917796	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFPT2 siRNA
20-abx917797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFPT2 antibody
70R-3650	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GFPT2 antibody raised against the middle region of GFPT2

GFPT2 antibody
70R-8530	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GFPT2 antibody

GFPT2 Antibody
40023-100ul	SAB	100ul	EUR 390

anti-GFPT2
YF-PA16595	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GFPT2

anti-GFPT2
YF-PA16596	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GFPT2

GFPT2 cloning plasmid
CSB-CL009378HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2049 Sequence: atgtgcggaatctttgcctacatgaactacagagtcccccggacgaggaaggagatcttcgaaaccctcatcaagggcctgcagcggctggagtacagaggctacgactcggcaggtgtggcgatcgatgggaataatcacgaagtcaaagaaagacacattcagctggtcaaga Show more
Description: A cloning plasmid for the GFPT2 gene.

anti- GFPT2 antibody
FNab03437	FN Test	100µg	EUR 585
Immunogen: glutamine-fructose-6-phosphate transaminase 2 Uniprot ID: O94808 Gene ID: 9945 Research Area: Metabolism
Description: Antibody raised against GFPT2

GFPT2 Rabbit pAb
A15374-100ul	Abclonal	100 ul	EUR 308

GFPT2 Rabbit pAb
A15374-200ul	Abclonal	200 ul	EUR 459

GFPT2 Rabbit pAb
A15374-20ul	Abclonal	20 ul	EUR 183

GFPT2 Rabbit pAb
A15374-50ul	Abclonal	50 ul	EUR 223

GFPT2 Blocking Peptide
33R-2065	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFPT2 antibody, catalog no. 70R-8530

GFPT2 Blocking Peptide
33R-8983	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFPT2 antibody, catalog no. 70R-3650

GFPT2 Polyclonal Antibody
28935-100ul	SAB	100ul	EUR 252

GFPT2 Polyclonal Antibody
28935-50ul	SAB	50ul	EUR 187

Anti-GFPT2 antibody
PAab03437	Lifescience Market	100 ug	EUR 412

Anti-GFPT2 antibody
STJ117569	St John's Laboratory	100 µl	EUR 277

Polyclonal GFPT2 Antibody (Center)
AMM04761G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GFPT2 (Center). This antibody is tested and proven to work in the following applications:

GFPT2 Polyclonal Conjugated Antibody
C28935	SAB	100ul	EUR 397

Rat GFPT2 shRNA Plasmid
20-abx990048	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Gfpt2 ELISA KIT
ELI-08170m	Lifescience Market	96 Tests	EUR 865

Human GFPT2 ELISA KIT
ELI-09551h	Lifescience Market	96 Tests	EUR 824

GFPT2 ELISA KIT|Human
EF009839	Lifescience Market	96 Tests	EUR 689

Bovine GFPT2 ELISA KIT
ELI-48644b	Lifescience Market	96 Tests	EUR 928

Human GFPT2 shRNA Plasmid
20-abx956686	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GFPT2 shRNA Plasmid
20-abx970518	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GFPT2 Recombinant Protein (Human)
RP013129	ABM	100 ug	Ask for price

GFPT2 Recombinant Protein (Rat)
RP202511	ABM	100 ug	Ask for price

GFPT2 Recombinant Protein (Mouse)
RP136331	ABM	100 ug	Ask for price

GFPT2 ORF Vector (Human) (pORF)
ORF004377	ABM	1.0 ug DNA	EUR 95

Gfpt2 ORF Vector (Rat) (pORF)
ORF067505	ABM	1.0 ug DNA	EUR 506

Gfpt2 ORF Vector (Mouse) (pORF)
ORF045445	ABM	1.0 ug DNA	EUR 506

GFPT2 ELISA Kit (Human) (OKCD00923)
OKCD00923	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Controls the flux of glucose into the hexosamine pathway. Most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

GFPT2 sgRNA CRISPR Lentivector set (Human)
K0852901	ABM	3 x 1.0 ug	EUR 339

Gfpt2 sgRNA CRISPR Lentivector set (Mouse)
K4721201	ABM	3 x 1.0 ug	EUR 339

Gfpt2 sgRNA CRISPR Lentivector set (Rat)
K7407301	ABM	3 x 1.0 ug	EUR 339

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0852902	ABM	1.0 ug DNA	EUR 154

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0852903	ABM	1.0 ug DNA	EUR 154

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0852904	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4721202	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4721203	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4721204	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7407302	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7407303	ABM	1.0 ug DNA	EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7407304	ABM	1.0 ug DNA	EUR 154

GFPT2 Protein Vector (Rat) (pPB-C-His)
PV270018	ABM	500 ng	EUR 1166

GFPT2 Protein Vector (Rat) (pPB-N-His)
PV270019	ABM	500 ng	EUR 1166

GFPT2 Protein Vector (Rat) (pPM-C-HA)
PV270020	ABM	500 ng	EUR 1166

GFPT2 Protein Vector (Rat) (pPM-C-His)
PV270021	ABM	500 ng	EUR 1166

GFPT2 Protein Vector (Mouse) (pPB-C-His)
PV181778	ABM	500 ng	EUR 1065

GFPT2 Protein Vector (Mouse) (pPB-N-His)
PV181779	ABM	500 ng	EUR 1065