Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit

DLR-GFPT2-Hu-96T 96T
EUR 673
  • Should the Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit

RD-GFPT2-Hu-48Tests 48 Tests
EUR 521

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit

RD-GFPT2-Hu-96Tests 96 Tests
EUR 723

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit

RDR-GFPT2-Hu-48Tests 48 Tests
EUR 544

Human Glutamine Fructose-6-Phosphate Transaminase 2 (GFPT2) ELISA Kit

RDR-GFPT2-Hu-96Tests 96 Tests
EUR 756

Gfpt2/ Rat Gfpt2 ELISA Kit

ELI-32629r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GFPT2 antibody

70R-3650 50 ug
EUR 467
Description: Rabbit polyclonal GFPT2 antibody raised against the middle region of GFPT2

GFPT2 antibody

70R-8530 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GFPT2 antibody

GFPT2 Antibody

40023-100ul 100ul
EUR 390


YF-PA16595 50 ug
EUR 363
Description: Mouse polyclonal to GFPT2


YF-PA16596 100 ug
EUR 403
Description: Rabbit polyclonal to GFPT2

GFPT2 cloning plasmid

CSB-CL009378HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2049
  • Sequence: atgtgcggaatctttgcctacatgaactacagagtcccccggacgaggaaggagatcttcgaaaccctcatcaagggcctgcagcggctggagtacagaggctacgactcggcaggtgtggcgatcgatgggaataatcacgaagtcaaagaaagacacattcagctggtcaaga
  • Show more
Description: A cloning plasmid for the GFPT2 gene.

anti- GFPT2 antibody

FNab03437 100µg
EUR 585
  • Immunogen: glutamine-fructose-6-phosphate transaminase 2
  • Uniprot ID: O94808
  • Gene ID: 9945
  • Research Area: Metabolism
Description: Antibody raised against GFPT2

GFPT2 Rabbit pAb

A15374-100ul 100 ul
EUR 308

GFPT2 Rabbit pAb

A15374-200ul 200 ul
EUR 459

GFPT2 Rabbit pAb

A15374-20ul 20 ul
EUR 183

GFPT2 Rabbit pAb

A15374-50ul 50 ul
EUR 223

GFPT2 Blocking Peptide

33R-2065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFPT2 antibody, catalog no. 70R-8530

GFPT2 Blocking Peptide

33R-8983 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFPT2 antibody, catalog no. 70R-3650

GFPT2 Polyclonal Antibody

28935-100ul 100ul
EUR 252

GFPT2 Polyclonal Antibody

28935-50ul 50ul
EUR 187

Anti-GFPT2 antibody

PAab03437 100 ug
EUR 412

Anti-GFPT2 antibody

STJ117569 100 µl
EUR 277

Polyclonal GFPT2 Antibody (Center)

AMM04761G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GFPT2 (Center). This antibody is tested and proven to work in the following applications:

GFPT2 Polyclonal Conjugated Antibody

C28935 100ul
EUR 397

Rat GFPT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gfpt2 ELISA KIT

ELI-08170m 96 Tests
EUR 865


ELI-09551h 96 Tests
EUR 824


EF009839 96 Tests
EUR 689


ELI-48644b 96 Tests
EUR 928

Human GFPT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GFPT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GFPT2 Recombinant Protein (Human)

RP013129 100 ug Ask for price

GFPT2 Recombinant Protein (Rat)

RP202511 100 ug Ask for price

GFPT2 Recombinant Protein (Mouse)

RP136331 100 ug Ask for price

GFPT2 ORF Vector (Human) (pORF)

ORF004377 1.0 ug DNA
EUR 95

Gfpt2 ORF Vector (Rat) (pORF)

ORF067505 1.0 ug DNA
EUR 506

Gfpt2 ORF Vector (Mouse) (pORF)

ORF045445 1.0 ug DNA
EUR 506

GFPT2 ELISA Kit (Human) (OKCD00923)

OKCD00923 96 Wells
EUR 831
Description: Description of target: Controls the flux of glucose into the hexosamine pathway. Most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

GFPT2 sgRNA CRISPR Lentivector set (Human)

K0852901 3 x 1.0 ug
EUR 339

Gfpt2 sgRNA CRISPR Lentivector set (Mouse)

K4721201 3 x 1.0 ug
EUR 339

Gfpt2 sgRNA CRISPR Lentivector set (Rat)

K7407301 3 x 1.0 ug
EUR 339

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0852902 1.0 ug DNA
EUR 154

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0852903 1.0 ug DNA
EUR 154

GFPT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0852904 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4721202 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4721203 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4721204 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7407302 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7407303 1.0 ug DNA
EUR 154

Gfpt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7407304 1.0 ug DNA
EUR 154

GFPT2 Protein Vector (Rat) (pPB-C-His)

PV270018 500 ng
EUR 1166

GFPT2 Protein Vector (Rat) (pPB-N-His)

PV270019 500 ng
EUR 1166

GFPT2 Protein Vector (Rat) (pPM-C-HA)

PV270020 500 ng
EUR 1166

GFPT2 Protein Vector (Rat) (pPM-C-His)

PV270021 500 ng
EUR 1166

GFPT2 Protein Vector (Mouse) (pPB-C-His)

PV181778 500 ng
EUR 1065

GFPT2 Protein Vector (Mouse) (pPB-N-His)

PV181779 500 ng
EUR 1065