GALNT11

GALNT11 siRNA

20-abx902080
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT11 siRNA

20-abx917520
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT11 siRNA

20-abx917521
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Galnt11 antibody

70R-8825 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Galnt11 antibody

GALNT11 Antibody

1-CSB-PA847687LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GALNT11 Antibody (HRP)

20-abx313734
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GALNT11 Antibody (FITC)

20-abx313735
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GALNT11 Antibody (Biotin)

20-abx313736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galnt11 Blocking Peptide

33R-4989 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Galnt11 antibody, catalog no. 70R-8825

GALNT11 cloning plasmid

CSB-CL847687HU-10ug 10ug
EUR 280
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 609
  • Sequence: atgggaagtgtcacagttcggtatttctgttatgggtgcctttttacatctgcgacctggacagttttgctttttgtttatttcaacttcagtgaagtgactcagccacttaagaatgtgcccgtcaaggggtctgggccccacggaccatctccaaaaaaattctatccccgttt
  • Show more
Description: A cloning plasmid for the GALNT11 gene.

Rat GALNT11 shRNA Plasmid

20-abx989702
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Galnt11 ELISA KIT

ELI-08126m 96 Tests
EUR 865

Human GALNT11 ELISA KIT

ELI-31127h 96 Tests
EUR 824

Mouse GALNT11 shRNA Plasmid

20-abx981851
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GALNT11 shRNA Plasmid

20-abx961859
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT11 Antibody, HRP conjugated

1-CSB-PA847687LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GALNT11 Antibody, FITC conjugated

1-CSB-PA847687LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GALNT11 Antibody, Biotin conjugated

1-CSB-PA847687LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GALNT11 Recombinant Protein (Human)

RP012868 100 ug Ask for price

GALNT11 Recombinant Protein (Rat)

RP202160 100 ug Ask for price

GALNT11 Recombinant Protein (Mouse)

RP135818 100 ug Ask for price

GALNT11 ORF Vector (Human) (pORF)

ORF004290 1.0 ug DNA
EUR 95

Galnt11 ORF Vector (Rat) (pORF)

ORF067388 1.0 ug DNA
EUR 506

Galnt11 ORF Vector (Mouse) (pORF)

ORF045274 1.0 ug DNA
EUR 506

GALNT11 ELISA Kit (Human) (OKCA01430)

OKCA01430 96 Wells
EUR 846
Description: Description of target: Polypeptide N-acetylgalactosaminyltransferase that catalyzes the initiation of protein O-linked glycosylation and is involved in left/right asymmetry by mediating O-glycosylation of NOTCH1. O-glycosylation of NOTCH1 promotes activation of NOTCH1, modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO). Polypeptide N-acetylgalactosaminyltransferases catalyze the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. Displays the same enzyme activity toward MUC1, MUC4, and EA2 than GALNT1. Not involved in glycosylation of erythropoietin (EPO).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Polypeptide N-Acetylgalactosaminyltransferase 11 (GALNT11) Antibody

20-abx313733
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galnt11 sgRNA CRISPR Lentivector set (Mouse)

K4591201 3 x 1.0 ug
EUR 339

GALNT11 sgRNA CRISPR Lentivector set (Human)

K0836101 3 x 1.0 ug
EUR 339

Galnt11 sgRNA CRISPR Lentivector set (Rat)

K7245701 3 x 1.0 ug
EUR 339

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4591202 1.0 ug DNA
EUR 154

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4591203 1.0 ug DNA
EUR 154

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4591204 1.0 ug DNA
EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0836102 1.0 ug DNA
EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0836103 1.0 ug DNA
EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0836104 1.0 ug DNA
EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7245702 1.0 ug DNA
EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7245703 1.0 ug DNA
EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7245704 1.0 ug DNA
EUR 154

GALNT11 Protein Vector (Rat) (pPB-C-His)

PV269550 500 ng
EUR 603

GALNT11 Protein Vector (Rat) (pPB-N-His)

PV269551 500 ng
EUR 603

GALNT11 Protein Vector (Rat) (pPM-C-HA)

PV269552 500 ng
EUR 603

GALNT11 Protein Vector (Rat) (pPM-C-His)

PV269553 500 ng
EUR 603

GALNT11 Protein Vector (Mouse) (pPB-C-His)

PV181094 500 ng
EUR 603

GALNT11 Protein Vector (Mouse) (pPB-N-His)

PV181095 500 ng
EUR 603

GALNT11 Protein Vector (Mouse) (pPM-C-HA)

PV181096 500 ng
EUR 603

GALNT11 Protein Vector (Mouse) (pPM-C-His)

PV181097 500 ng
EUR 603

GALNT11 Protein Vector (Human) (pPB-C-His)

PV017157 500 ng
EUR 329

GALNT11 Protein Vector (Human) (pPB-N-His)

PV017158 500 ng
EUR 329

GALNT11 Protein Vector (Human) (pPM-C-HA)

PV017159 500 ng
EUR 329

GALNT11 Protein Vector (Human) (pPM-C-His)

PV017160 500 ng
EUR 329

Galnt11 3'UTR Luciferase Stable Cell Line

TU204924 1.0 ml Ask for price

Galnt11 3'UTR GFP Stable Cell Line

TU156881 1.0 ml Ask for price

GALNT11 3'UTR Luciferase Stable Cell Line

TU008530 1.0 ml
EUR 1521

Galnt11 3'UTR Luciferase Stable Cell Line

TU106881 1.0 ml Ask for price

GALNT11 3'UTR GFP Stable Cell Line

TU058530 1.0 ml
EUR 1521

Galnt11 3'UTR GFP Stable Cell Line

TU254924 1.0 ml Ask for price

GALNT11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661405 1.0 ug DNA
EUR 682

GALNT11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661409 1.0 ug DNA
EUR 682

GALNT11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661410 1.0 ug DNA
EUR 682

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4591205 3 x 1.0 ug
EUR 376

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0836105 3 x 1.0 ug
EUR 376

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7245705 3 x 1.0 ug
EUR 376

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4591206 1.0 ug DNA
EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4591207 1.0 ug DNA
EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4591208 1.0 ug DNA
EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0836106 1.0 ug DNA
EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0836107 1.0 ug DNA
EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0836108 1.0 ug DNA
EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7245706 1.0 ug DNA
EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7245707 1.0 ug DNA
EUR 167