GALNT11

GALNT11 siRNA
20-abx902080	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT11 siRNA
20-abx917520	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT11 siRNA
20-abx917521	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Galnt11 antibody
70R-8825	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Galnt11 antibody

GALNT11 Antibody
1-CSB-PA847687LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GALNT11 Antibody (HRP)
20-abx313734	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GALNT11 Antibody (FITC)
20-abx313735	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GALNT11 Antibody (Biotin)
20-abx313736	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Galnt11 Blocking Peptide
33R-4989	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Galnt11 antibody, catalog no. 70R-8825

GALNT11 cloning plasmid
CSB-CL847687HU-10ug	Cusabio	10ug	EUR 280
Formulation: 10 μg plasmid + 200μl Glycerol Length: 609 Sequence: atgggaagtgtcacagttcggtatttctgttatgggtgcctttttacatctgcgacctggacagttttgctttttgtttatttcaacttcagtgaagtgactcagccacttaagaatgtgcccgtcaaggggtctgggccccacggaccatctccaaaaaaattctatccccgttt Show more
Description: A cloning plasmid for the GALNT11 gene.

Rat GALNT11 shRNA Plasmid
20-abx989702	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Galnt11 ELISA KIT
ELI-08126m	Lifescience Market	96 Tests	EUR 865

Human GALNT11 ELISA KIT
ELI-31127h	Lifescience Market	96 Tests	EUR 824

Mouse GALNT11 shRNA Plasmid
20-abx981851	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT11 shRNA Plasmid
20-abx961859	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GALNT11 Antibody, HRP conjugated
1-CSB-PA847687LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GALNT11 Antibody, FITC conjugated
1-CSB-PA847687LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GALNT11 Antibody, Biotin conjugated
1-CSB-PA847687LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT11. Recognizes GALNT11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GALNT11 Recombinant Protein (Human)
RP012868	ABM	100 ug	Ask for price

GALNT11 Recombinant Protein (Rat)
RP202160	ABM	100 ug	Ask for price

GALNT11 Recombinant Protein (Mouse)
RP135818	ABM	100 ug	Ask for price

GALNT11 ORF Vector (Human) (pORF)
ORF004290	ABM	1.0 ug DNA	EUR 95

Galnt11 ORF Vector (Rat) (pORF)
ORF067388	ABM	1.0 ug DNA	EUR 506

Galnt11 ORF Vector (Mouse) (pORF)
ORF045274	ABM	1.0 ug DNA	EUR 506

GALNT11 ELISA Kit (Human) (OKCA01430)
OKCA01430	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Polypeptide N-acetylgalactosaminyltransferase that catalyzes the initiation of protein O-linked glycosylation and is involved in left/right asymmetry by mediating O-glycosylation of NOTCH1. O-glycosylation of NOTCH1 promotes activation of NOTCH1, modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO). Polypeptide N-acetylgalactosaminyltransferases catalyze the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. Displays the same enzyme activity toward MUC1, MUC4, and EA2 than GALNT1. Not involved in glycosylation of erythropoietin (EPO).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Polypeptide N-Acetylgalactosaminyltransferase 11 (GALNT11) Antibody
20-abx313733	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Galnt11 sgRNA CRISPR Lentivector set (Mouse)
K4591201	ABM	3 x 1.0 ug	EUR 339

GALNT11 sgRNA CRISPR Lentivector set (Human)
K0836101	ABM	3 x 1.0 ug	EUR 339

Galnt11 sgRNA CRISPR Lentivector set (Rat)
K7245701	ABM	3 x 1.0 ug	EUR 339

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4591202	ABM	1.0 ug DNA	EUR 154

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4591203	ABM	1.0 ug DNA	EUR 154

Galnt11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4591204	ABM	1.0 ug DNA	EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 1)
K0836102	ABM	1.0 ug DNA	EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 2)
K0836103	ABM	1.0 ug DNA	EUR 154

GALNT11 sgRNA CRISPR Lentivector (Human) (Target 3)
K0836104	ABM	1.0 ug DNA	EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7245702	ABM	1.0 ug DNA	EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7245703	ABM	1.0 ug DNA	EUR 154

Galnt11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7245704	ABM	1.0 ug DNA	EUR 154

GALNT11 Protein Vector (Rat) (pPB-C-His)
PV269550	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Rat) (pPB-N-His)
PV269551	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Rat) (pPM-C-HA)
PV269552	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Rat) (pPM-C-His)
PV269553	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Mouse) (pPB-C-His)
PV181094	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Mouse) (pPB-N-His)
PV181095	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Mouse) (pPM-C-HA)
PV181096	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Mouse) (pPM-C-His)
PV181097	ABM	500 ng	EUR 603

GALNT11 Protein Vector (Human) (pPB-C-His)
PV017157	ABM	500 ng	EUR 329

GALNT11 Protein Vector (Human) (pPB-N-His)
PV017158	ABM	500 ng	EUR 329

GALNT11 Protein Vector (Human) (pPM-C-HA)
PV017159	ABM	500 ng	EUR 329

GALNT11 Protein Vector (Human) (pPM-C-His)
PV017160	ABM	500 ng	EUR 329

Galnt11 3'UTR Luciferase Stable Cell Line
TU204924	ABM	1.0 ml	Ask for price

Galnt11 3'UTR GFP Stable Cell Line
TU156881	ABM	1.0 ml	Ask for price

GALNT11 3'UTR Luciferase Stable Cell Line
TU008530	ABM	1.0 ml	EUR 1521

Galnt11 3'UTR Luciferase Stable Cell Line
TU106881	ABM	1.0 ml	Ask for price

GALNT11 3'UTR GFP Stable Cell Line
TU058530	ABM	1.0 ml	EUR 1521

Galnt11 3'UTR GFP Stable Cell Line
TU254924	ABM	1.0 ml	Ask for price

GALNT11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV661405	ABM	1.0 ug DNA	EUR 682

GALNT11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV661409	ABM	1.0 ug DNA	EUR 682

GALNT11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV661410	ABM	1.0 ug DNA	EUR 682

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4591205	ABM	3 x 1.0 ug	EUR 376

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0836105	ABM	3 x 1.0 ug	EUR 376

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7245705	ABM	3 x 1.0 ug	EUR 376

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4591206	ABM	1.0 ug DNA	EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4591207	ABM	1.0 ug DNA	EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4591208	ABM	1.0 ug DNA	EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0836106	ABM	1.0 ug DNA	EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0836107	ABM	1.0 ug DNA	EUR 167

GALNT11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0836108	ABM	1.0 ug DNA	EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7245706	ABM	1.0 ug DNA	EUR 167

Galnt11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7245707	ABM	1.0 ug DNA	EUR 167