GALNT10 Antibody

24939-100ul 100ul
EUR 390

GALNT10 Antibody

24940-100ul 100ul
EUR 390

GALNT10 antibody

70R-5370 50 ug
EUR 467
Description: Rabbit polyclonal GALNT10 antibody raised against the N terminal Of Galnt10


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26344 50 ul
EUR 334
Description: Mouse polyclonal to GALNT10

GALNT10 Polyclonal Antibody

28754-100ul 100ul
EUR 252

GALNT10 Polyclonal Antibody

28754-50ul 50ul
EUR 187

GALNT10 Blocking Peptide

33R-9717 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT10 antibody, catalog no. 70R-5370

GALNT10 cloning plasmid

CSB-CL771426HU-10ug 10ug
EUR 280
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 609
  • Sequence: atgaggcggaaggagaagcggctcctgcaggcggtggcgctggtgctggcggccctggtcctcctgcccaacgtggggctttgggcgctgtaccgcgagcggcagcccgacggcacccctgggggatcgggggcggcggtggcgccggcggcgggacagggctcacacagtcgaca
  • Show more
Description: A cloning plasmid for the GALNT10 gene.

GALNT10 Rabbit pAb

A14909-100ul 100 ul
EUR 308

GALNT10 Rabbit pAb

A14909-200ul 200 ul
EUR 459

GALNT10 Rabbit pAb

A14909-20ul 20 ul
EUR 183

GALNT10 Rabbit pAb

A14909-50ul 50 ul
EUR 223

Anti-GALNT10 antibody

STJ117109 100 µl
EUR 277
Description: This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.

Mouse Galnt10 ELISA KIT

ELI-31125m 96 Tests
EUR 865

Rat GALNT10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT10 Polyclonal Conjugated Antibody

C28754 100ul
EUR 397

Human GALNT10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GALNT10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48013h 96 Tests
EUR 824

GALNT10 Recombinant Protein (Human)

RP012865 100 ug Ask for price

GALNT10 Recombinant Protein (Rat)

RP202157 100 ug Ask for price

GALNT10 Recombinant Protein (Mouse)

RP135815 100 ug Ask for price

Galnt10 ORF Vector (Rat) (pORF)

ORF067387 1.0 ug DNA
EUR 506

h GALNT10 inducible lentiviral particles

LVP756 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h GALNT10 (polypeptide N-acetylgalactosaminyltransferase 10), [alternative names: GALNACT10; PPGALNACT10; PPGANTASE10]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005811. It also contains a RFP-Blasticidin dual selection marker.

GALNT10 ORF Vector (Human) (pORF)

ORF004289 1.0 ug DNA
EUR 95

Galnt10 ORF Vector (Mouse) (pORF)

ORF045273 1.0 ug DNA
EUR 506

Galnt10 sgRNA CRISPR Lentivector set (Rat)

K7118001 3 x 1.0 ug
EUR 339

GALNT10 sgRNA CRISPR Lentivector set (Human)

K0836001 3 x 1.0 ug
EUR 339

Galnt10 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7118002 1.0 ug DNA
EUR 154

Galnt10 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7118003 1.0 ug DNA
EUR 154

Galnt10 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7118004 1.0 ug DNA
EUR 154

GALNT10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0836002 1.0 ug DNA
EUR 154

GALNT10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0836003 1.0 ug DNA
EUR 154

GALNT10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0836004 1.0 ug DNA
EUR 154

GALNT10 Protein Vector (Rat) (pPB-C-His)

PV269546 500 ng
EUR 603

GALNT10 Protein Vector (Rat) (pPB-N-His)

PV269547 500 ng
EUR 603

GALNT10 Protein Vector (Rat) (pPM-C-HA)

PV269548 500 ng
EUR 603

GALNT10 Protein Vector (Rat) (pPM-C-His)

PV269549 500 ng
EUR 603

GALNT10 Protein Vector (Mouse) (pPB-C-His)

PV181090 500 ng
EUR 603

GALNT10 Protein Vector (Mouse) (pPB-N-His)

PV181091 500 ng
EUR 603

GALNT10 Protein Vector (Mouse) (pPM-C-HA)

PV181092 500 ng
EUR 603

GALNT10 Protein Vector (Mouse) (pPM-C-His)

PV181093 500 ng
EUR 603

GALNT10 Protein Vector (Human) (pPB-C-His)

PV017153 500 ng
EUR 329

GALNT10 Protein Vector (Human) (pPB-N-His)

PV017154 500 ng
EUR 329

GALNT10 Protein Vector (Human) (pPM-C-HA)

PV017155 500 ng
EUR 329

GALNT10 Protein Vector (Human) (pPM-C-His)

PV017156 500 ng
EUR 329

Galnt10 3'UTR Luciferase Stable Cell Line

TU204923 1.0 ml Ask for price

Galnt10 3'UTR GFP Stable Cell Line

TU254923 1.0 ml Ask for price

GALNT10 3'UTR GFP Stable Cell Line

TU058529 1.0 ml
EUR 2333

GALNT10 3'UTR Luciferase Stable Cell Line

TU008529 1.0 ml
EUR 2333

GALNT10 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667429 1.0 ug DNA
EUR 682

GALNT10 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667433 1.0 ug DNA
EUR 682

GALNT10 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667434 1.0 ug DNA
EUR 682

Galnt10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7118005 3 x 1.0 ug
EUR 376

GALNT10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0836005 3 x 1.0 ug
EUR 376

GALNT10 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV667430 1.0 ug DNA
EUR 682

GALNT10 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV667431 1.0 ug DNA
EUR 740

GALNT10 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV667432 1.0 ug DNA
EUR 740

Galnt10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7118006 1.0 ug DNA
EUR 167

Galnt10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7118007 1.0 ug DNA
EUR 167

Galnt10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7118008 1.0 ug DNA
EUR 167

GALNT10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0836006 1.0 ug DNA
EUR 167

GALNT10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0836007 1.0 ug DNA
EUR 167

GALNT10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0836008 1.0 ug DNA
EUR 167