

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUK antibody

70R-31998 100 ug
EUR 327
Description: Rabbit polyclonal FUK antibody

FUK Antibody

ABD3347 100 ug
EUR 438

FUK Antibody

48477-100ul 100ul
EUR 333

FUK Antibody

48477-50ul 50ul
EUR 239

FUK Antibody

47958-100ul 100ul
EUR 252

FUK antibody

10R-10989 100 ug
EUR 349
Description: Mouse monoclonal FUK antibody

FUK antibody

70R-17366 50 ul
EUR 435
Description: Rabbit polyclonal FUK antibody

FUK Antibody

DF3347 200ul
EUR 304
Description: FUK Antibody detects endogenous levels of total FUK.

FUK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FUK. Recognizes FUK from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

FUK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUK. Recognizes FUK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

FUK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FUK. Recognizes FUK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


YF-PA22661 50 ul
EUR 363
Description: Mouse polyclonal to FUK


YF-PA22662 50 ug
EUR 363
Description: Mouse polyclonal to FUK


YF-PA22663 100 ug
EUR 403
Description: Rabbit polyclonal to FUK


YF-PA26958 50 ul
EUR 334
Description: Mouse polyclonal to FUK

FUK Conjugated Antibody

C47958 100ul
EUR 397

FUK Conjugated Antibody

C48477 100ul
EUR 397

FUK Blocking Peptide

BF0687-BP 1mg
EUR 195

anti- FUK antibody

FNab03239 100µg
EUR 505.25
  • Immunogen: fucokinase
  • Uniprot ID: Q8N0W3
  • Gene ID: 197258
  • Research Area: Metabolism
Description: Antibody raised against FUK

Fucokinase (FUK) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

abx146109-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

abx011701-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody

abx233239-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-FUK Antibody

EUR 370

FUK Polyclonal Antibody

A70107 100 ?g
EUR 628.55
Description: reagents widely cited

FUK Blocking Peptide

DF3347-BP 1mg
EUR 195

FUK cloning plasmid

CSB-CL847604HU-10ug 10ug
EUR 943
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2973
  • Sequence: atgggtcgagacttcccctttgatgactgtggcagggctttcacctgcctccccgtggagaaccccgaggcccccgtggaagccttggtctgcaacctggactgcctgctggacatcatgacctatcggctgggcccgggctccccgccaggcgtgtgggtctgcagcaccgaca
  • Show more
Description: A cloning plasmid for the FUK gene.

Anti-FUK antibody

PAab03239 100 ug
EUR 355

anti-FUK (6E2)

LF-MA30570 100 ul
EUR 527
Description: Mouse Monoclonal to FUK


EF009708 96 Tests
EUR 689

Fucokinase (FUK) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucokinase (FUK) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human FUK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FUK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUK. Recognizes FUK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FUK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUK. Recognizes FUK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FUK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUK. Recognizes FUK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Monoclonal FUK Antibody, Clone: 6E2

APR11094G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human FUK. The antibodies are raised in Mouse and are from clone 6E2. This antibody is applicable in WB, FC, E

Polyclonal FUK Antibody (aa11-60)

APR16042G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FUK (aa11-60). This antibody is tested and proven to work in the following applications:

Human Fucokinase (FUK) ELISA Kit

abx387431-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FUK Polyclonal Antibody, HRP Conjugated

A70108 100 ?g
EUR 628.55
Description: Ask the seller for details

FUK Polyclonal Antibody, FITC Conjugated

A70109 100 ?g
EUR 628.55
Description: The best epigenetics products

FUK Polyclonal Antibody, Biotin Conjugated

A70110 100 ?g
EUR 628.55
Description: kits suitable for this type of research

FUK ORF Vector (Human) (pORF)

ORF004214 1.0 ug DNA
EUR 95

Fuk ORF Vector (Rat) (pORF)

ORF067290 1.0 ug DNA
EUR 506

Fuk ORF Vector (Mouse) (pORF)

ORF045131 1.0 ug DNA
EUR 506

Fuk ORF Vector (Mouse) (pORF)

ORF045132 1.0 ug DNA
EUR 506

Human Fucokinase(FUK)ELISA Kit

QY-E00546 96T
EUR 413

Fuk sgRNA CRISPR Lentivector set (Rat)

K6141501 3 x 1.0 ug
EUR 339

FUK sgRNA CRISPR Lentivector set (Human)

K0821301 3 x 1.0 ug
EUR 339

Fuk sgRNA CRISPR Lentivector set (Mouse)

K3130501 3 x 1.0 ug
EUR 339

Human L- fucose kinase, FUK ELISA KIT

ELI-47356h 96 Tests
EUR 824

Fuk sgRNA CRISPR Lentivector (Rat) (Target 1)

K6141502 1.0 ug DNA
EUR 154

Fuk sgRNA CRISPR Lentivector (Rat) (Target 2)

K6141503 1.0 ug DNA
EUR 154

Fuk sgRNA CRISPR Lentivector (Rat) (Target 3)

K6141504 1.0 ug DNA
EUR 154

FUK sgRNA CRISPR Lentivector (Human) (Target 1)

K0821302 1.0 ug DNA
EUR 154

FUK sgRNA CRISPR Lentivector (Human) (Target 2)

K0821303 1.0 ug DNA
EUR 154

FUK sgRNA CRISPR Lentivector (Human) (Target 3)

K0821304 1.0 ug DNA
EUR 154

Fuk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3130502 1.0 ug DNA
EUR 154

Fuk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3130503 1.0 ug DNA
EUR 154

Fuk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3130504 1.0 ug DNA
EUR 154

FUK Protein Vector (Rat) (pPB-C-His)

PV269158 500 ng
EUR 1166

FUK Protein Vector (Rat) (pPB-N-His)

PV269159 500 ng
EUR 1166

FUK Protein Vector (Rat) (pPM-C-HA)

PV269160 500 ng
EUR 1166

FUK Protein Vector (Rat) (pPM-C-His)

PV269161 500 ng
EUR 1166

FUK Protein Vector (Mouse) (pPB-C-His)

PV180522 500 ng
EUR 1065