FBXO5 antibody

70R-2793 50 ug
EUR 467
Description: Rabbit polyclonal FBXO5 antibody raised against the C terminal of FBXO5

FBXO5 Antibody

40044-100ul 100ul
EUR 390

FBXO5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO5. Recognizes FBXO5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17827 2 ug
EUR 231


YF-PA25993 50 ul
EUR 334
Description: Mouse polyclonal to FBXO5

FBXO5 Blocking Peptide

33R-1541 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO5 antibody, catalog no. 70R-2793

FBXO5 cloning plasmid

CSB-CL890922HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgagccggcgcccctgcagctgcgccctacggccaccccgctgctcctgcagcgccagccccagcgcagtgacagccgccgggcgccctcgaccctcggatagttgtaaagaagaaagttctaccctttctgtcaaaatgaagtgtgattttaattgtaaccatgttcattccg
  • Show more
Description: A cloning plasmid for the FBXO5 gene.

FBXO5 Rabbit pAb

A18449-100ul 100 ul
EUR 308

FBXO5 Rabbit pAb

A18449-200ul 200 ul
EUR 459

FBXO5 Rabbit pAb

A18449-20ul 20 ul
EUR 183

FBXO5 Rabbit pAb

A18449-50ul 50 ul
EUR 223

anti- FBXO5 antibody

FNab03047 100µg
EUR 548.75
  • Immunogen: F-box protein 5
  • Uniprot ID: Q9UKT4
  • Gene ID: 26271
  • Research Area: Metabolism
Description: Antibody raised against FBXO5

Anti-FBXO5 antibody

PAab03047 100 ug
EUR 386

Anti-FBXO5 antibody

STJ11100403 100 µl
EUR 277

Anti-FBXO5 (5H7)

YF-MA18088 50 ug
EUR 363
Description: Mouse monoclonal to FBXO5

Anti-FBXO5 (5H7)

YF-MA18089 200 ul
EUR 363
Description: Mouse monoclonal to FBXO5


EF009588 96 Tests
EUR 689

Mouse FBXO5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBXO5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXO5 Recombinant Protein (Human)

RP011935 100 ug Ask for price

FBXO5 Recombinant Protein (Rat)

RP201053 100 ug Ask for price

FBXO5 Recombinant Protein (Mouse)

RP134060 100 ug Ask for price

Fbxo5 ORF Vector (Rat) (pORF)

ORF067019 1.0 ug DNA
EUR 506

FBXO5 ORF Vector (Human) (pORF)

ORF003979 1.0 ug DNA
EUR 95

Fbxo5 ORF Vector (Mouse) (pORF)

ORF044688 1.0 ug DNA
EUR 506

F-Box Protein 5 (FBXO5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box Protein 5 (FBXO5) Antibody

abx036548-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box Protein 5 (FBXO5) Antibody

abx233047-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Fbxo5 sgRNA CRISPR Lentivector set (Rat)

K6432101 3 x 1.0 ug
EUR 339

FBXO5 sgRNA CRISPR Lentivector set (Human)

K0763801 3 x 1.0 ug
EUR 339

Fbxo5 sgRNA CRISPR Lentivector set (Mouse)

K4537601 3 x 1.0 ug
EUR 339

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6432102 1.0 ug DNA
EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6432103 1.0 ug DNA
EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6432104 1.0 ug DNA
EUR 154

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0763802 1.0 ug DNA
EUR 154

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0763803 1.0 ug DNA
EUR 154

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0763804 1.0 ug DNA
EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4537602 1.0 ug DNA
EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4537603 1.0 ug DNA
EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4537604 1.0 ug DNA
EUR 154

FBXO5 Protein Vector (Mouse) (pPB-C-His)

PV178750 500 ng
EUR 603

FBXO5 Protein Vector (Mouse) (pPB-N-His)

PV178751 500 ng
EUR 603

FBXO5 Protein Vector (Mouse) (pPM-C-HA)

PV178752 500 ng
EUR 603

FBXO5 Protein Vector (Mouse) (pPM-C-His)

PV178753 500 ng
EUR 603

FBXO5 Protein Vector (Rat) (pPB-C-His)

PV268074 500 ng
EUR 603

FBXO5 Protein Vector (Rat) (pPB-N-His)

PV268075 500 ng
EUR 603

FBXO5 Protein Vector (Rat) (pPM-C-HA)

PV268076 500 ng
EUR 603

FBXO5 Protein Vector (Rat) (pPM-C-His)

PV268077 500 ng
EUR 603

FBXO5 Protein Vector (Human) (pPB-C-His)

PV015913 500 ng
EUR 329

FBXO5 Protein Vector (Human) (pPB-N-His)

PV015914 500 ng
EUR 329

FBXO5 Protein Vector (Human) (pPM-C-HA)

PV015915 500 ng
EUR 329

FBXO5 Protein Vector (Human) (pPM-C-His)

PV015916 500 ng
EUR 329

Fbxo5 3'UTR GFP Stable Cell Line

TU156441 1.0 ml Ask for price

Fbxo5 3'UTR Luciferase Stable Cell Line

TU106441 1.0 ml Ask for price

Fbxo5 3'UTR Luciferase Stable Cell Line

TU204521 1.0 ml Ask for price

Fbxo5 3'UTR GFP Stable Cell Line

TU254521 1.0 ml Ask for price

FBXO5 3'UTR GFP Stable Cell Line

TU057774 1.0 ml
EUR 1394

FBXO5 3'UTR Luciferase Stable Cell Line

TU007774 1.0 ml
EUR 1394

Human F-Box Protein 5 (FBXO5) ELISA Kit

abx387324-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat F box only protein 5(FBXO5) ELISA kit

E02F0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 5(FBXO5) ELISA kit

E02F0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 5(FBXO5) ELISA kit

E02F0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit

E03F0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit

E03F0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit

E03F0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 5(FBXO5) ELISA kit

E04F0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 5(FBXO5) ELISA kit

E04F0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box only protein 5(FBXO5) ELISA kit

E04F0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.