FBXO5

FBXO5 siRNA
20-abx916649	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXO5 antibody
70R-2793	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FBXO5 antibody raised against the C terminal of FBXO5

FBXO5 Antibody
40044-100ul	SAB	100ul	EUR 390

FBXO5 antibody
70R-17262	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FBXO5 antibody

FBXO5 Antibody
1-CSB-PA008514GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO5. Recognizes FBXO5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-FBXO5
PVT17827	Lifescience Market	2 ug	EUR 231

anti-FBXO5
YF-PA25993	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FBXO5

anti- FBXO5 antibody
FNab03047	FN Test	100µg	EUR 548.75
Immunogen: F-box protein 5 Uniprot ID: Q9UKT4 Gene ID: 26271 Research Area: Metabolism
Description: Antibody raised against FBXO5

FBXO5 Rabbit pAb
A18449-100ul	Abclonal	100 ul	EUR 308

FBXO5 Rabbit pAb
A18449-200ul	Abclonal	200 ul	EUR 459

FBXO5 Rabbit pAb
A18449-20ul	Abclonal	20 ul	EUR 183

FBXO5 Rabbit pAb
A18449-50ul	Abclonal	50 ul	EUR 223

FBXO5 Blocking Peptide
33R-1541	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO5 antibody, catalog no. 70R-2793

FBXO5 cloning plasmid
CSB-CL890922HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1344 Sequence: atgagccggcgcccctgcagctgcgccctacggccaccccgctgctcctgcagcgccagccccagcgcagtgacagccgccgggcgccctcgaccctcggatagttgtaaagaagaaagttctaccctttctgtcaaaatgaagtgtgattttaattgtaaccatgttcattccg Show more
Description: A cloning plasmid for the FBXO5 gene.

Anti-FBXO5 antibody
PAab03047	Lifescience Market	100 ug	EUR 386

Anti-FBXO5 antibody
STJ11100403	St John's Laboratory	100 µl	EUR 277

Anti-FBXO5 (5H7)
YF-MA18088	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to FBXO5

Anti-FBXO5 (5H7)
YF-MA18089	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to FBXO5

Mouse FBXO5 shRNA Plasmid
20-abx975996	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXO5 ELISA KIT|Human
EF009588	Lifescience Market	96 Tests	EUR 689

Human FBXO5 shRNA Plasmid
20-abx958794	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXO5 Recombinant Protein (Human)
RP011935	ABM	100 ug	Ask for price

FBXO5 Recombinant Protein (Rat)
RP201053	ABM	100 ug	Ask for price

FBXO5 Recombinant Protein (Mouse)
RP134060	ABM	100 ug	Ask for price

FBXO5 ORF Vector (Human) (pORF)
ORF003979	ABM	1.0 ug DNA	EUR 95

Fbxo5 ORF Vector (Rat) (pORF)
ORF067019	ABM	1.0 ug DNA	EUR 506

Fbxo5 ORF Vector (Mouse) (pORF)
ORF044688	ABM	1.0 ug DNA	EUR 506

FBXO5 sgRNA CRISPR Lentivector set (Human)
K0763801	ABM	3 x 1.0 ug	EUR 339

F-Box Protein 5 (FBXO5) Antibody
20-abx112499	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

F-Box Protein 5 (FBXO5) Antibody
abx036548-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

F-Box Protein 5 (FBXO5) Antibody
abx233047-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Fbxo5 sgRNA CRISPR Lentivector set (Mouse)
K4537601	ABM	3 x 1.0 ug	EUR 339

Fbxo5 sgRNA CRISPR Lentivector set (Rat)
K6432101	ABM	3 x 1.0 ug	EUR 339

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0763802	ABM	1.0 ug DNA	EUR 154

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0763803	ABM	1.0 ug DNA	EUR 154

FBXO5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0763804	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4537602	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4537603	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4537604	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6432102	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6432103	ABM	1.0 ug DNA	EUR 154

Fbxo5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6432104	ABM	1.0 ug DNA	EUR 154

FBXO5 Protein Vector (Mouse) (pPB-C-His)
PV178750	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Mouse) (pPB-N-His)
PV178751	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Mouse) (pPM-C-HA)
PV178752	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Mouse) (pPM-C-His)
PV178753	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Human) (pPB-C-His)
PV015913	ABM	500 ng	EUR 329

FBXO5 Protein Vector (Human) (pPB-N-His)
PV015914	ABM	500 ng	EUR 329

FBXO5 Protein Vector (Human) (pPM-C-HA)
PV015915	ABM	500 ng	EUR 329

FBXO5 Protein Vector (Human) (pPM-C-His)
PV015916	ABM	500 ng	EUR 329

FBXO5 Protein Vector (Rat) (pPB-C-His)
PV268074	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Rat) (pPB-N-His)
PV268075	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Rat) (pPM-C-HA)
PV268076	ABM	500 ng	EUR 603

FBXO5 Protein Vector (Rat) (pPM-C-His)
PV268077	ABM	500 ng	EUR 603

Fbxo5 3'UTR Luciferase Stable Cell Line
TU204521	ABM	1.0 ml	Ask for price

Fbxo5 3'UTR GFP Stable Cell Line
TU156441	ABM	1.0 ml	Ask for price

FBXO5 3'UTR Luciferase Stable Cell Line
TU007774	ABM	1.0 ml	EUR 1394

Fbxo5 3'UTR Luciferase Stable Cell Line
TU106441	ABM	1.0 ml	Ask for price

FBXO5 3'UTR GFP Stable Cell Line
TU057774	ABM	1.0 ml	EUR 1394

Fbxo5 3'UTR GFP Stable Cell Line
TU254521	ABM	1.0 ml	Ask for price

Human F-Box Protein 5 (FBXO5) ELISA Kit
abx387324-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Goat F box only protein 5(FBXO5) ELISA kit
E06F0306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 5(FBXO5) ELISA kit
E06F0306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box only protein 5(FBXO5) ELISA kit
E06F0306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 5(FBXO5) ELISA kit
E02F0306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 5(FBXO5) ELISA kit
E02F0306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box only protein 5(FBXO5) ELISA kit
E02F0306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit
E03F0306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit
E03F0306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box only protein 5(FBXO5) ELISA kit
E03F0306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box only protein 5(FBXO5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.