EXOC2

EXOC2 siRNA
20-abx901795	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC2 siRNA
20-abx915793	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC2 siRNA
20-abx915794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC2 Antibody
1-CSB-PA007878ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC2. Recognizes EXOC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EXOC2 Antibody
1-CSB-PA007878GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC2. Recognizes EXOC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXOC2 cloning plasmid
CSB-CL007878HU-10ug	Cusabio	10ug	EUR 887
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2775 Sequence: atgtctcgatcacgacaacccccccttgtgaccggcatctctccaaatgaagggataccatggacgaaggtcacaatcaggggagaaaatctggggactggccccaccgacctcataggcttgaccatttgtggacataattgcctcctgacggcagaatggatgtctgcaagta Show more
Description: A cloning plasmid for the EXOC2 gene.

EXOC2 Rabbit pAb
A8235-100ul	Abclonal	100 ul	EUR 308

EXOC2 Rabbit pAb
A8235-200ul	Abclonal	200 ul	EUR 459

EXOC2 Rabbit pAb
A8235-20ul	Abclonal	20 ul	EUR 183

EXOC2 Rabbit pAb
A8235-50ul	Abclonal	50 ul	EUR 223

EXOC2 Polyclonal Antibody
31481-100ul	SAB	100ul	EUR 252

EXOC2 Polyclonal Antibody
31481-50ul	SAB	50ul	EUR 187

SEC5/EXOC2 Antibody
DF12043	Affbiotech	200ul	EUR 304
Description: SEC5/EXOC2 antibody detects endogenous levels of SEC5/EXOC2.

Anti-EXOC2 antibody
STJ110534	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants.

Anti-EXOC2 antibody
STJ11100824	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants.

EXOC2 Polyclonal Conjugated Antibody
C31481	SAB	100ul	EUR 397

Mouse EXOC2 shRNA Plasmid
20-abx975635	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat EXOC2 shRNA Plasmid
20-abx987780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- SEC5/EXOC2 antibody
FNab07684	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: exocyst complex component 2 Uniprot ID: Q96KP1 Research Area: Signal Transduction
Description: Antibody raised against SEC5/EXOC2

anti- SEC5/EXOC2 antibody
FNab07685	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:2500-1:10000 IP: 1:500-1:1000 IHC: 1:200-1:800 IF: 1:10-1:100 Immunogen: exocyst complex component 2 Uniprot ID: Q96KP1 Research Area: Signal Transduction
Description: Antibody raised against SEC5/EXOC2

Human EXOC2 shRNA Plasmid
20-abx960906	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC5/EXOC2 Blocking Peptide
DF12043-BP	Affbiotech	1mg	EUR 195

Anti-SEC5/EXOC2 antibody
PAab07684	Lifescience Market	100 ug	EUR 355

SEC5/EXOC2 ELISA KIT|Human
EF002793	Lifescience Market	96 Tests	EUR 689

[KO Validated] EXOC2 Rabbit pAb
A19948-100ul	Abclonal	100 ul	EUR 410

[KO Validated] EXOC2 Rabbit pAb
A19948-200ul	Abclonal	200 ul	EUR 571

[KO Validated] EXOC2 Rabbit pAb
A19948-20ul	Abclonal	20 ul	EUR 221

[KO Validated] EXOC2 Rabbit pAb
A19948-50ul	Abclonal	50 ul	EUR 287

EXOC2 ORF Vector (Human) (pORF)
ORF003680	ABM	1.0 ug DNA	EUR 95

Exoc2 ORF Vector (Rat) (pORF)
ORF066694	ABM	1.0 ug DNA	EUR 506

Exoc2 ORF Vector (Mouse) (pORF)
ORF044157	ABM	1.0 ug DNA	EUR 506

Exocyst Complex Component 2 (EXOC2) Antibody
20-abx112403	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody
abx037078-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody
20-abx006103	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody
20-abx320465	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody
abx237684-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Exocyst Complex Component 2 (EXOC2) Antibody
abx237685-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

EXOC2 sgRNA CRISPR Lentivector set (Human)
K0702201	ABM	3 x 1.0 ug	EUR 339

Exoc2 sgRNA CRISPR Lentivector set (Mouse)
K5012601	ABM	3 x 1.0 ug	EUR 339

Exoc2 sgRNA CRISPR Lentivector set (Rat)
K7058501	ABM	3 x 1.0 ug	EUR 339

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0702202	ABM	1.0 ug DNA	EUR 154

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0702203	ABM	1.0 ug DNA	EUR 154

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0702204	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5012602	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5012603	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5012604	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7058502	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7058503	ABM	1.0 ug DNA	EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7058504	ABM	1.0 ug DNA	EUR 154

EXOC2 Protein Vector (Mouse) (pPB-C-His)
PV176626	ABM	500 ng	EUR 1065

EXOC2 Protein Vector (Mouse) (pPB-N-His)
PV176627	ABM	500 ng	EUR 1065

EXOC2 Protein Vector (Mouse) (pPM-C-HA)
PV176628	ABM	500 ng	EUR 1065

EXOC2 Protein Vector (Mouse) (pPM-C-His)
PV176629	ABM	500 ng	EUR 1065

EXOC2 Protein Vector (Human) (pPB-C-His)
PV014717	ABM	500 ng	EUR 329

EXOC2 Protein Vector (Human) (pPB-N-His)
PV014718	ABM	500 ng	EUR 329

EXOC2 Protein Vector (Human) (pPM-C-HA)
PV014719	ABM	500 ng	EUR 329

EXOC2 Protein Vector (Human) (pPM-C-His)
PV014720	ABM	500 ng	EUR 329

EXOC2 Protein Vector (Rat) (pPB-C-His)
PV266774	ABM	500 ng	EUR 1191

EXOC2 Protein Vector (Rat) (pPB-N-His)
PV266775	ABM	500 ng	EUR 1191

EXOC2 Protein Vector (Rat) (pPM-C-HA)
PV266776	ABM	500 ng	EUR 1191

EXOC2 Protein Vector (Rat) (pPM-C-His)
PV266777	ABM	500 ng	EUR 1191

Exoc2 3'UTR Luciferase Stable Cell Line
TU204147	ABM	1.0 ml	Ask for price

Exoc2 3'UTR GFP Stable Cell Line
TU156005	ABM	1.0 ml	Ask for price

EXOC2 3'UTR Luciferase Stable Cell Line
TU007118	ABM	1.0 ml	EUR 1521

Exoc2 3'UTR Luciferase Stable Cell Line
TU106005	ABM	1.0 ml	Ask for price

EXOC2 3'UTR GFP Stable Cell Line
TU057118	ABM	1.0 ml	EUR 1521

Exoc2 3'UTR GFP Stable Cell Line
TU254147	ABM	1.0 ml	Ask for price

Mouse Exocyst complex component 2, Exoc2 ELISA KIT
ELI-20565m	Lifescience Market	96 Tests	EUR 865

Human Exocyst complex component 2, EXOC2 ELISA KIT
ELI-27371h	Lifescience Market	96 Tests	EUR 824

Human Exocyst Complex Component 2 (EXOC2) ELISA Kit
abx259834-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.