EIF4B

EIF4B Antibody
BF0398	Affbiotech	200ul	EUR 376
Description: EIF4B antibody detects endogenous levels of total EIF4B.

eIF4B Antibody
AF7767	Affbiotech	200ul	EUR 376
Description: eIF4B Antibody detects endogenous levels of eIF4B.

eIF4B Antibody
AF7768	Affbiotech	200ul	EUR 376
Description: eIF4B Antibody detects endogenous levels of eIF4B.

eIF4B Antibody
ABF5408	Lifescience Market	100 ug	EUR 438

EIF4B siRNA
20-abx915195	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF4B siRNA
20-abx915196	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF4B antibody
70R-4927	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EIF4B antibody raised against the middle region of EIF4B

eIF4B antibody
70R-34968	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal eIF4B antibody

EIF4B Antibody
ABD7324	Lifescience Market	100 ug	EUR 438

EIF4B Antibody
32833-100ul	SAB	100ul	EUR 252

eIF4B antibody
20R-2156	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal eIF4B antibody

eIF4B antibody
20R-2665	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal eIF4B antibody

EIF4B antibody
70R-17056	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EIF4B antibody

EIF4B antibody
70R-1418	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal EIF4B antibody raised against the C terminal of EIF4B

EIF4B Antibody
DF7324	Affbiotech	200ul	EUR 304
Description: EIF4B Antibody detects endogenous levels of total EIF4B.

EIF4B Antibody
1-CSB-PA007554GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EIF4B Antibody
1-CSB-PA007554LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF4B Antibody
1-CSB-PA007988	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

anti-eIF4B
YF-PA11520	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to eIF4B

eIF4B Blocking Peptide
AF5408-BP	Affbiotech	1mg	EUR 195

EIF4B Blocking Peptide
BF0398-BP	Affbiotech	1mg	EUR 195

eIF4B Blocking Peptide
AF7767-BP	Affbiotech	1mg	EUR 195

eIF4B Blocking Peptide
AF7768-BP	Affbiotech	1mg	EUR 195

EIF4B cloning plasmid
CSB-CL007554HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1836 Sequence: atggcggcctcagcaaaaaagaagaataagaaggggaagactatctccctaacagactttctggctgaggatgggggtactggtggaggaagcacctatgtttccaaaccagtcagctgggctgatgaaacggatgacctggaaggagatgtttcgaccacttggcacagtaacg Show more
Description: A cloning plasmid for the EIF4B gene.

anti- EIF4B antibody
FNab02720	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: eukaryotic translation initiation factor 4B Uniprot ID: P23588 Gene ID: 1975 Research Area: Metabolism
Description: Antibody raised against EIF4B

eIF4B Polyclonal Antibody
ES5075-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against eIF4B from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

eIF4B Polyclonal Antibody
ES5075-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against eIF4B from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

EIF4B (pS422) Antibody
20-abx000329	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

eIF4B Polyclonal Antibody
ABP54076-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422 Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B Polyclonal Antibody
ABP54076-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422 Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B Polyclonal Antibody
ABP54076-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422 Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B (pS422) Antibody
abx215118-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

EIF4B Rabbit pAb
A5405-100ul	Abclonal	100 ul	EUR 308

EIF4B Rabbit pAb
A5405-200ul	Abclonal	200 ul	EUR 459

EIF4B Rabbit pAb
A5405-20ul	Abclonal	20 ul	EUR 183

EIF4B Rabbit pAb
A5405-50ul	Abclonal	50 ul	EUR 223

eIF4B antibody (Ser422)
70R-36673	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal eIF4B antibody (Ser422)

eIF4B antibody (Ser422)
70R-37387	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal eIF4B antibody (Ser422)

EIF4B Rabbit pAb
A13300-100ul	Abclonal	100 ul	EUR 308

EIF4B Rabbit pAb
A13300-200ul	Abclonal	200 ul	EUR 459

EIF4B Rabbit pAb
A13300-20ul	Abclonal	20 ul	EUR 183

EIF4B Rabbit pAb
A13300-50ul	Abclonal	50 ul	EUR 223

EIF4B Blocking Peptide
33R-6824	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4B antibody, catalog no. 70R-1418

EIF4B Blocking Peptide
33R-7750	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4B antibody, catalog no. 70R-4927

EIF4B Blocking Peptide
DF7324-BP	Affbiotech	1mg	EUR 195

Anti-EIF4B antibody
PAab02720	Lifescience Market	100 ug	EUR 386

anti-EIF4B (1F5)
LF-MA30728	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to EIF4B

Anti-eIF4B antibody
STJ92880	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to eIF4B.

Anti-EIF4B antibody
STJ27358	St John's Laboratory	100 µl	EUR 277

Anti-EIF4B antibody
STJ115264	St John's Laboratory	100 µl	EUR 277

Phospho-eIF4B (Ser422) Antibody
AF5428	Affbiotech	200ul	EUR 304
Description: eIF4B (Phospho-Ser422) Antibody detects endogenous levels of total eIF4B (Phospho-Ser422).

eIF4B Cell ELISA Kit
abx595196-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Mouse EIF4B shRNA Plasmid
20-abx978475	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-eIF4B (Thr420) Antibody
AF7267	Affbiotech	200ul	EUR 376
Description: Phospho-eIF4B (Thr420) Antibody detects endogenous levels of eIF4B only when phosphorylated at Thr420.

Phospho-eIF4B (Ser497) Antibody
AF7268	Affbiotech	200ul	EUR 376
Description: Phospho-eIF4B (Ser497) Antibody detects endogenous levels of eIF4B only when phosphorylated at Ser497.

EIF4B ELISA KIT|Human
EF009351	Lifescience Market	96 Tests	EUR 689

Human EIF4B ELISA KIT
ELI-30972h	Lifescience Market	96 Tests	EUR 824

Mouse Eif4b ELISA KIT
ELI-48212m	Lifescience Market	96 Tests	EUR 865

eIF4B (Phospho-Ser422) Antibody
20-abx012458	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Phospho- eIF4B (Ser406) Antibody
ABF3578	Lifescience Market	100 ug	EUR 438

eIF4B (Phospho- Ser422) Antibody
ABF5428	Lifescience Market	100 ug	EUR 438

Human EIF4B shRNA Plasmid
20-abx951366	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

eIF4B (Phospho-Thr420) Antibody
13121-100ul	SAB	100ul	EUR 252

eIF4B (Phospho-Thr420) Antibody
13121-50ul	SAB	50ul	EUR 187

eIF4B (Phospho-Ser497) Antibody
13122-100ul	SAB	100ul	EUR 252

eIF4B (Phospho-Ser497) Antibody
13122-50ul	SAB	50ul	EUR 187

eIF4B (phospho-Ser422) Antibody
11513-100ul	SAB	100ul	EUR 252

eIF4B (phospho-Ser422) Antibody
11513-50ul	SAB	50ul	EUR 187

eIF4B (Ab-422) Antibody
21513-100ul	SAB	100ul	EUR 252

eIF4B (Ab-422) Antibody
21513-50ul	SAB	50ul	EUR 187