EIF4B

EIF4B Antibody

BF0398 200ul
EUR 376
Description: EIF4B antibody detects endogenous levels of total EIF4B.

eIF4B Antibody

AF7767 200ul
EUR 376
Description: eIF4B Antibody detects endogenous levels of eIF4B.

eIF4B Antibody

AF7768 200ul
EUR 376
Description: eIF4B Antibody detects endogenous levels of eIF4B.

eIF4B Antibody

ABF5408 100 ug
EUR 438

EIF4B siRNA

20-abx915195
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4B siRNA

20-abx915196
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4B antibody

70R-4927 50 ug
EUR 467
Description: Rabbit polyclonal EIF4B antibody raised against the middle region of EIF4B

eIF4B antibody

70R-34968 100 ug
EUR 327
Description: Purified Rabbit polyclonal eIF4B antibody

EIF4B Antibody

ABD7324 100 ug
EUR 438

EIF4B Antibody

32833-100ul 100ul
EUR 252

eIF4B antibody

20R-2156 50 ug
EUR 281
Description: Rabbit polyclonal eIF4B antibody

eIF4B antibody

20R-2665 50 ug
EUR 281
Description: Rabbit polyclonal eIF4B antibody

EIF4B antibody

70R-17056 50 ul
EUR 435
Description: Rabbit polyclonal EIF4B antibody

EIF4B antibody

70R-1418 100 ug
EUR 377
Description: Rabbit polyclonal EIF4B antibody raised against the C terminal of EIF4B

EIF4B Antibody

DF7324 200ul
EUR 304
Description: EIF4B Antibody detects endogenous levels of total EIF4B.

EIF4B Antibody

1-CSB-PA007554GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EIF4B Antibody

1-CSB-PA007554LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF4B Antibody

1-CSB-PA007988
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4B. Recognizes EIF4B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

anti-eIF4B

YF-PA11520 50 ug
EUR 363
Description: Mouse polyclonal to eIF4B

eIF4B Blocking Peptide

AF5408-BP 1mg
EUR 195

EIF4B Blocking Peptide

BF0398-BP 1mg
EUR 195

eIF4B Blocking Peptide

AF7767-BP 1mg
EUR 195

eIF4B Blocking Peptide

AF7768-BP 1mg
EUR 195

EIF4B cloning plasmid

CSB-CL007554HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1836
  • Sequence: atggcggcctcagcaaaaaagaagaataagaaggggaagactatctccctaacagactttctggctgaggatgggggtactggtggaggaagcacctatgtttccaaaccagtcagctgggctgatgaaacggatgacctggaaggagatgtttcgaccacttggcacagtaacg
  • Show more
Description: A cloning plasmid for the EIF4B gene.

anti- EIF4B antibody

FNab02720 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 4B
  • Uniprot ID: P23588
  • Gene ID: 1975
  • Research Area: Metabolism
Description: Antibody raised against EIF4B

eIF4B Polyclonal Antibody

ES5075-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against eIF4B from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

eIF4B Polyclonal Antibody

ES5075-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against eIF4B from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

EIF4B (pS422) Antibody

20-abx000329
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

eIF4B Polyclonal Antibody

ABP54076-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B Polyclonal Antibody

ABP54076-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B Polyclonal Antibody

ABP54076-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4B from Human, Mouse. This eIF4B antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4B around the non-phosphorylation site of S422

eIF4B (pS422) Antibody

abx215118-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

EIF4B Rabbit pAb

A5405-100ul 100 ul
EUR 308

EIF4B Rabbit pAb

A5405-200ul 200 ul
EUR 459

EIF4B Rabbit pAb

A5405-20ul 20 ul
EUR 183

EIF4B Rabbit pAb

A5405-50ul 50 ul
EUR 223

eIF4B antibody (Ser422)

70R-36673 100 ug
EUR 327
Description: Rabbit Polyclonal eIF4B antibody (Ser422)

eIF4B antibody (Ser422)

70R-37387 100 ug
EUR 349
Description: Rabbit Polyclonal eIF4B antibody (Ser422)

EIF4B Rabbit pAb

A13300-100ul 100 ul
EUR 308

EIF4B Rabbit pAb

A13300-200ul 200 ul
EUR 459

EIF4B Rabbit pAb

A13300-20ul 20 ul
EUR 183

EIF4B Rabbit pAb

A13300-50ul 50 ul
EUR 223

EIF4B Blocking Peptide

33R-6824 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4B antibody, catalog no. 70R-1418

EIF4B Blocking Peptide

33R-7750 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4B antibody, catalog no. 70R-4927

EIF4B Blocking Peptide

DF7324-BP 1mg
EUR 195

Anti-EIF4B antibody

PAab02720 100 ug
EUR 386

anti-EIF4B (1F5)

LF-MA30728 100 ul
EUR 527
Description: Mouse Monoclonal to EIF4B

Anti-eIF4B antibody

STJ92880 200 µl
EUR 197
Description: Rabbit polyclonal to eIF4B.

Anti-EIF4B antibody

STJ27358 100 µl
EUR 277

Anti-EIF4B antibody

STJ115264 100 µl
EUR 277

Phospho-eIF4B (Ser422) Antibody

AF5428 200ul
EUR 304
Description: eIF4B (Phospho-Ser422) Antibody detects endogenous levels of total eIF4B (Phospho-Ser422).

eIF4B Cell ELISA Kit

abx595196-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse EIF4B shRNA Plasmid

20-abx978475
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-eIF4B (Thr420) Antibody

AF7267 200ul
EUR 376
Description: Phospho-eIF4B (Thr420) Antibody detects endogenous levels of eIF4B only when phosphorylated at Thr420.

Phospho-eIF4B (Ser497) Antibody

AF7268 200ul
EUR 376
Description: Phospho-eIF4B (Ser497) Antibody detects endogenous levels of eIF4B only when phosphorylated at Ser497.

EIF4B ELISA KIT|Human

EF009351 96 Tests
EUR 689

Human EIF4B ELISA KIT

ELI-30972h 96 Tests
EUR 824

Mouse Eif4b ELISA KIT

ELI-48212m 96 Tests
EUR 865

eIF4B (Phospho-Ser422) Antibody

20-abx012458
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phospho- eIF4B (Ser406) Antibody

ABF3578 100 ug
EUR 438

eIF4B (Phospho- Ser422) Antibody

ABF5428 100 ug
EUR 438

Human EIF4B shRNA Plasmid

20-abx951366
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

eIF4B (Phospho-Thr420) Antibody

13121-100ul 100ul
EUR 252

eIF4B (Phospho-Thr420) Antibody

13121-50ul 50ul
EUR 187

eIF4B (Phospho-Ser497) Antibody

13122-100ul 100ul
EUR 252

eIF4B (Phospho-Ser497) Antibody

13122-50ul 50ul
EUR 187

eIF4B (phospho-Ser422) Antibody

11513-100ul 100ul
EUR 252

eIF4B (phospho-Ser422) Antibody

11513-50ul 50ul
EUR 187

eIF4B (Ab-422) Antibody

21513-100ul 100ul
EUR 252

eIF4B (Ab-422) Antibody

21513-50ul 50ul
EUR 187