  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL2 antibody

70R-35321 100 ug
EUR 327
Description: Purified Rabbit polyclonal DYNLL2 antibody

DYNLL2 antibody

70R-2312 50 ug
EUR 467
Description: Rabbit polyclonal DYNLL2 antibody raised against the N terminal of DYNLL2

DYNLL2 Antibody

42890-100ul 100ul
EUR 252

DYNLL2 antibody

70R-16967 50 ul
EUR 435
Description: Rabbit polyclonal DYNLL2 antibody

DYNLL2 Antibody

DF12966 200ul
EUR 304
Description: DYNLL2 Antibody detects endogenous levels of DYNLL2.

DYNLL2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DYNLL2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

DYNLL2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

DYNLL2 Conjugated Antibody

C42890 100ul
EUR 397

anti- DYNLL2 antibody

FNab02588 100µg
EUR 548.75
  • Immunogen: dynein, light chain, LC8-type 2
  • Uniprot ID: Q96FJ2
  • Gene ID: 140735
  • Research Area: Developmental biology
Description: Antibody raised against DYNLL2

DYNLL2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DYNLL2 Polyclonal Antibody

A58874 100 µg
EUR 570.55
Description: reagents widely cited

Anti-DYNLL2 Antibody

A30657 100ul
EUR 397
Description: Rabbit Polyclonal DYNLL2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

DYNLL2 Rabbit pAb

A13888-100ul 100 ul
EUR 308

DYNLL2 Rabbit pAb

A13888-200ul 200 ul
EUR 459

DYNLL2 Rabbit pAb

A13888-20ul 20 ul
EUR 183

DYNLL2 Rabbit pAb

A13888-50ul 50 ul
EUR 223

DYNLL2 Rabbit pAb

A13889-100ul 100 ul
EUR 308

DYNLL2 Rabbit pAb

A13889-200ul 200 ul
EUR 459

DYNLL2 Rabbit pAb

A13889-20ul 20 ul
EUR 183

DYNLL2 Rabbit pAb

A13889-50ul 50 ul
EUR 223

DYNLL2 Blocking Peptide

33R-6410 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL2 antibody, catalog no. 70R-2312

DYNLL2 Blocking Peptide

DF12966-BP 1mg
EUR 195

DYNLL2 cloning plasmid

CSB-CL839322HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: atgtctgaccggaaggcagtgatcaagaacgcagacatgtctgaggacatgcaacaggatgccgttgactgcgccacgcaggccatggagaagtacaatatagagaaggacattgctgcctatatcaagaaggaatttgacaagaaatataaccctacctggcattgtatcgtggg
  • Show more
Description: A cloning plasmid for the DYNLL2 gene.

Anti-DYNLL2 antibody

PAab02588 100 ug
EUR 386

Anti-DYNLL2 antibody

STJ115827 100 µl
EUR 277

Anti-DYNLL2 antibody

STJ115828 100 µl
EUR 277

Mouse DYNLL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DYNLL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYNLL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009257 96 Tests
EUR 689

DYNLL2 protein (His tag)

80R-1843 100 ug
EUR 305
Description: Purified recombinant DYNLL2 protein

DYNLL2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNLL2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNLL2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNLL2 Recombinant Protein (Human)

RP010033 100 ug Ask for price

DYNLL2 Recombinant Protein (Rat)

RP198893 100 ug Ask for price

DYNLL2 Recombinant Protein (Mouse)

RP130427 100 ug Ask for price

DYNLL2 Recombinant Protein (Mouse)

RP130430 100 ug Ask for price

DYNLL2 Recombinant Protein (Mouse)

RP130433 100 ug Ask for price

DYNLL2 Polyclonal Antibody, Biotin Conjugated

A58875 100 µg
EUR 570.55
Description: Ask the seller for details

DYNLL2 Polyclonal Antibody, FITC Conjugated

A58876 100 µg
EUR 570.55
Description: The best epigenetics products

DYNLL2 Polyclonal Antibody, HRP Conjugated

A58877 100 µg
EUR 570.55
Description: kits suitable for this type of research

DYNLL2 ORF Vector (Human) (pORF)

ORF003345 1.0 ug DNA
EUR 95

Dynll2 ORF Vector (Rat) (pORF)

ORF066299 1.0 ug DNA
EUR 506

Dynll2 ORF Vector (Mouse) (pORF)

ORF043477 1.0 ug DNA
EUR 506

Dynll2 ORF Vector (Mouse) (pORF)

ORF043478 1.0 ug DNA
EUR 506

Dynll2 ORF Vector (Mouse) (pORF)

ORF043479 1.0 ug DNA
EUR 506

DYNLL2 sgRNA CRISPR Lentivector set (Human)

K0644101 3 x 1.0 ug
EUR 339

Dynll2 sgRNA CRISPR Lentivector set (Mouse)

K4575701 3 x 1.0 ug
EUR 339

Dynll2 sgRNA CRISPR Lentivector set (Rat)

K7037101 3 x 1.0 ug
EUR 339

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0644102 1.0 ug DNA
EUR 154

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0644103 1.0 ug DNA
EUR 154

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0644104 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4575702 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4575703 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4575704 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7037102 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7037103 1.0 ug DNA
EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7037104 1.0 ug DNA
EUR 154

DYNLL2 Protein Vector (Mouse) (pPB-C-His)

PV173906 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-N-His)

PV173907 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-HA)

PV173908 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-His)

PV173909 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-C-His)

PV173910 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-N-His)

PV173911 500 ng
EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-HA)

PV173912 500 ng
EUR 603