DYNLL2

DYNLL2 antibody
70R-16967	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DYNLL2 antibody

DYNLL2 antibody
70R-2312	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DYNLL2 antibody raised against the N terminal of DYNLL2

DYNLL2 Antibody
42890-100ul	SAB	100ul	EUR 252

DYNLL2 Antibody
1-CSB-PA839322LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

DYNLL2 Antibody
DF12966	Affbiotech	200ul	EUR 304
Description: DYNLL2 Antibody detects endogenous levels of DYNLL2.

DYNLL2 antibody
70R-35321	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal DYNLL2 antibody

DYNLL2 Antibody
1-CSB-PA007302GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DYNLL2 Antibody
1-CSB-PA007308	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

DYNLL2 siRNA
20-abx901616	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNLL2 siRNA
20-abx914813	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNLL2 siRNA
20-abx914814	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNLL2 Rabbit pAb
A13888-100ul	Abclonal	100 ul	EUR 308

DYNLL2 Rabbit pAb
A13888-200ul	Abclonal	200 ul	EUR 459

DYNLL2 Rabbit pAb
A13888-20ul	Abclonal	20 ul	EUR 183

DYNLL2 Rabbit pAb
A13888-50ul	Abclonal	50 ul	EUR 223

DYNLL2 Rabbit pAb
A13889-100ul	Abclonal	100 ul	EUR 308

DYNLL2 Rabbit pAb
A13889-200ul	Abclonal	200 ul	EUR 459

DYNLL2 Rabbit pAb
A13889-20ul	Abclonal	20 ul	EUR 183

DYNLL2 Rabbit pAb
A13889-50ul	Abclonal	50 ul	EUR 223

DYNLL2 Blocking Peptide
33R-6410	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL2 antibody, catalog no. 70R-2312

DYNLL2 Blocking Peptide
DF12966-BP	Affbiotech	1mg	EUR 195

DYNLL2 Blocking Peptide
20-abx162397	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

DYNLL2 Conjugated Antibody
C42890	SAB	100ul	EUR 397

DYNLL2 cloning plasmid
CSB-CL839322HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 270 Sequence: atgtctgaccggaaggcagtgatcaagaacgcagacatgtctgaggacatgcaacaggatgccgttgactgcgccacgcaggccatggagaagtacaatatagagaaggacattgctgcctatatcaagaaggaatttgacaagaaatataaccctacctggcattgtatcgtggg Show more
Description: A cloning plasmid for the DYNLL2 gene.

DYNLL2 Polyclonal Antibody
A58874	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-DYNLL2 Antibody
A30657	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal DYNLL2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

anti- DYNLL2 antibody
FNab02588	FN Test	100µg	EUR 548.75
Immunogen: dynein, light chain, LC8-type 2 Uniprot ID: Q96FJ2 Gene ID: 140735 Research Area: Developmental biology
Description: Antibody raised against DYNLL2

Anti-DYNLL2 antibody
PAab02588	Lifescience Market	100 ug	EUR 386

Anti-DYNLL2 antibody
STJ115827	St John's Laboratory	100 µl	EUR 277

Anti-DYNLL2 antibody
STJ115828	St John's Laboratory	100 µl	EUR 277

DYNLL2 Antibody, HRP conjugated
1-CSB-PA839322LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNLL2 Antibody, FITC conjugated
1-CSB-PA839322LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNLL2 Antibody, Biotin conjugated
1-CSB-PA839322LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL2. Recognizes DYNLL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNLL2 protein (His tag)
80R-1843	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant DYNLL2 protein

DYNLL2 ELISA KIT|Human
EF009257	Lifescience Market	96 Tests	EUR 689

Mouse DYNLL2 shRNA Plasmid
20-abx976489	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DYNLL2 shRNA Plasmid
20-abx965314	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat DYNLL2 shRNA Plasmid
20-abx987530	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DYNLL2 Recombinant Protein (Human)
RP010033	ABM	100 ug	Ask for price

DYNLL2 Recombinant Protein (Rat)
RP198893	ABM	100 ug	Ask for price

DYNLL2 Recombinant Protein (Mouse)
RP130427	ABM	100 ug	Ask for price

DYNLL2 Recombinant Protein (Mouse)
RP130430	ABM	100 ug	Ask for price

DYNLL2 Recombinant Protein (Mouse)
RP130433	ABM	100 ug	Ask for price

DYNLL2 Polyclonal Antibody, Biotin Conjugated
A58875	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DYNLL2 Polyclonal Antibody, FITC Conjugated
A58876	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DYNLL2 Polyclonal Antibody, HRP Conjugated
A58877	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Dynll2 ORF Vector (Rat) (pORF)
ORF066299	ABM	1.0 ug DNA	EUR 506

DYNLL2 ORF Vector (Human) (pORF)
ORF003345	ABM	1.0 ug DNA	EUR 95

Dynll2 ORF Vector (Mouse) (pORF)
ORF043477	ABM	1.0 ug DNA	EUR 506

Dynll2 ORF Vector (Mouse) (pORF)
ORF043478	ABM	1.0 ug DNA	EUR 506

Dynll2 ORF Vector (Mouse) (pORF)
ORF043479	ABM	1.0 ug DNA	EUR 506

DYNLL2 sgRNA CRISPR Lentivector set (Human)
K0644101	ABM	3 x 1.0 ug	EUR 339

Dynll2 sgRNA CRISPR Lentivector set (Rat)
K7037101	ABM	3 x 1.0 ug	EUR 339

Dynll2 sgRNA CRISPR Lentivector set (Mouse)
K4575701	ABM	3 x 1.0 ug	EUR 339

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0644102	ABM	1.0 ug DNA	EUR 154

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0644103	ABM	1.0 ug DNA	EUR 154

DYNLL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0644104	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7037102	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7037103	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7037104	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4575702	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4575703	ABM	1.0 ug DNA	EUR 154

Dynll2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4575704	ABM	1.0 ug DNA	EUR 154

DYNLL2 Protein Vector (Mouse) (pPB-C-His)
PV173906	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-N-His)
PV173907	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-HA)
PV173908	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-His)
PV173909	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-C-His)
PV173910	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPB-N-His)
PV173911	ABM	500 ng	EUR 603

DYNLL2 Protein Vector (Mouse) (pPM-C-HA)
PV173912	ABM	500 ng	EUR 603