DYNC1LI1

DYNC1LI1 Antibody

47086-100ul 100ul
EUR 252

DYNC1LI1 antibody

10R-3925 100 ul
EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody

10R-3926 100 ul
EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody

10R-3927 100 ul
EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody

10R-3929 100 ul
EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody

10R-3930 100 ul
EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 Antibody

1-CSB-PA897312LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

DYNC1LI1 siRNA

20-abx901611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1LI1 siRNA

20-abx914803
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1LI1 siRNA

20-abx914804
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1LI1 cloning plasmid

CSB-CL897312HU-10ug 10ug
EUR 549
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1572
  • Sequence: ATGGCGGCCGTGGGGCGAGTCGGCTCCTTCGGTTCTTCTCCGCCGGGATTATCCTCGACTTACACTGGCGGCCCCTTGGGCAACGAGATAGCGTCGGGCAACGGTGGCGCCGCGGCAGGCGACGACGAGGACGGGCAGAACCTTTGGTCCTGCATCCTCAGCGAGGTCTCCACCC
  • Show more
Description: A cloning plasmid for the DYNC1LI1 gene.

DYNC1LI1 Conjugated Antibody

C47086 100ul
EUR 397

anti- DYNC1LI1 antibody

FNab02585 100µg
EUR 585
  • Immunogen: dynein, cytoplasmic 1, light intermediate chain 1
  • Uniprot ID: Q9Y6G9
  • Gene ID: 51143
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DYNC1LI1

Recombinant human DYNC1LI1

P2454 100ug Ask for price
  • Uniprot ID: Q9Y6G9
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DYNC1LI1

Anti-DYNC1LI1 antibody

PAab02585 100 ug
EUR 412

DYNC1LI1 Antibody, HRP conjugated

1-CSB-PA897312LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNC1LI1 Antibody, FITC conjugated

1-CSB-PA897312LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNC1LI1 Antibody, Biotin conjugated

1-CSB-PA897312LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Chicken DYNC1LI1 ELISA KIT

ELI-08968c 96 Tests
EUR 928

DYNC1LI1 ELISA KIT|Human

EF009254 96 Tests
EUR 689

Rat DYNC1LI1 shRNA Plasmid

20-abx988021
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYNC1LI1 shRNA Plasmid

20-abx959559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DYNC1LI1 shRNA Plasmid

20-abx982235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYNC1LI1 ELISA KIT

ELI-32127h 96 Tests
EUR 824

Mouse Dync1li1 ELISA KIT

ELI-46844m 96 Tests
EUR 865

DYNC1LI1 Recombinant Protein (Human)

RP038680 100 ug Ask for price

DYNC1LI1 Recombinant Protein (Rat)

RP198878 100 ug Ask for price

DYNC1LI1 Recombinant Protein (Mouse)

RP130412 100 ug Ask for price

Dync1li1 ORF Vector (Rat) (pORF)

ORF066294 1.0 ug DNA
EUR 506

DYNC1LI1 ORF Vector (Human) (pORF)

ORF012894 1.0 ug DNA
EUR 354

Dync1li1 ORF Vector (Mouse) (pORF)

ORF043472 1.0 ug DNA
EUR 506

Dync1li1 sgRNA CRISPR Lentivector set (Mouse)

K4994701 3 x 1.0 ug
EUR 339

DYNC1LI1 sgRNA CRISPR Lentivector set (Human)

K0643401 3 x 1.0 ug
EUR 339

Dync1li1 sgRNA CRISPR Lentivector set (Rat)

K7355501 3 x 1.0 ug
EUR 339

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4994702 1.0 ug DNA
EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4994703 1.0 ug DNA
EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4994704 1.0 ug DNA
EUR 154

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0643402 1.0 ug DNA
EUR 154

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0643403 1.0 ug DNA
EUR 154

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0643404 1.0 ug DNA
EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7355502 1.0 ug DNA
EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7355503 1.0 ug DNA
EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7355504 1.0 ug DNA
EUR 154

DYNC1LI1 Protein Vector (Mouse) (pPB-C-His)

PV173886 500 ng
EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPB-N-His)

PV173887 500 ng
EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPM-C-HA)

PV173888 500 ng
EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPM-C-His)

PV173889 500 ng
EUR 603

DYNC1LI1 Protein Vector (Rat) (pPB-C-His)

PV265174 500 ng
EUR 603

DYNC1LI1 Protein Vector (Rat) (pPB-N-His)

PV265175 500 ng
EUR 603

DYNC1LI1 Protein Vector (Rat) (pPM-C-HA)

PV265176 500 ng
EUR 603

DYNC1LI1 Protein Vector (Rat) (pPM-C-His)

PV265177 500 ng
EUR 603

DYNC1LI1 Protein Vector (Human) (pPB-C-His)

PV051573 500 ng
EUR 481

DYNC1LI1 Protein Vector (Human) (pPB-N-His)

PV051574 500 ng
EUR 481

DYNC1LI1 Protein Vector (Human) (pPM-C-HA)

PV051575 500 ng
EUR 481

DYNC1LI1 Protein Vector (Human) (pPM-C-His)

PV051576 500 ng
EUR 481

Dync1li1 3'UTR GFP Stable Cell Line

TU155481 1.0 ml Ask for price

Dync1li1 3'UTR Luciferase Stable Cell Line

TU105481 1.0 ml Ask for price

Dync1li1 3'UTR Luciferase Stable Cell Line

TU203713 1.0 ml Ask for price

Dync1li1 3'UTR GFP Stable Cell Line

TU253713 1.0 ml Ask for price

DYNC1LI1 3'UTR GFP Stable Cell Line

TU056455 1.0 ml
EUR 1394

DYNC1LI1 3'UTR Luciferase Stable Cell Line

TU006455 1.0 ml
EUR 1394

DYNC1LI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV676063 1.0 ug DNA
EUR 682

DYNC1LI1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV676067 1.0 ug DNA
EUR 682

DYNC1LI1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV676068 1.0 ug DNA
EUR 682

Dynein Cytoplasmic 1 Light Intermediate Chain 1 (DYNC1LI1) Antibody

abx232585-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Dync1li1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4994705 3 x 1.0 ug
EUR 376

DYNC1LI1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0643405 3 x 1.0 ug
EUR 376

Dync1li1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7355505 3 x 1.0 ug
EUR 376

Rat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) ELISA kit

E02C2277-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) ELISA kit

E02C2277-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.