DCTN3

DCTN3 siRNA

20-abx913700
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCTN3 Antibody

ABD8351 100 ug
EUR 438

DCTN3 Antibody

36403-100ul 100ul
EUR 252

DCTN3 Antibody

DF8351 200ul
EUR 304
Description: DCTN3 Antibody detects endogenous levels of total DCTN3.

DCTN3 Antibody

1-CSB-PA921442
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

DCTN3 Antibody

1-CSB-PA006566ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DCTN3 Antibody

1-CSB-PA006566ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DCTN3 Antibody

1-CSB-PA006566LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DCTN3 Antibody

1-CSB-PA210409
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

anti-DCTN3

YF-PA17547 50 ul
EUR 363
Description: Mouse polyclonal to DCTN3

anti-DCTN3

YF-PA17548 50 ug
EUR 363
Description: Mouse polyclonal to DCTN3

DCTN3 Conjugated Antibody

C36403 100ul
EUR 397

DCTN3 cloning plasmid

CSB-CL006566HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atggcgggtctgactgacttgcagcggctacaggcccgagtggaagagctggagcgctgggtgtacgggccgggcggggcgcgcggctcacggaaggtggctgacggcctggtcaaggtgcaggtggctttggggaacatttccagcaagagggagagggtgaagattctctacaa
  • Show more
Description: A cloning plasmid for the DCTN3 gene.

DCTN3 Polyclonal Antibody

A57037 100 µg
EUR 570.55
Description: The best epigenetics products

DCTN3 Blocking Peptide

DF8351-BP 1mg
EUR 195

pENTR223-DCTN3 vector

PVT11860 2 ug
EUR 304

Anti-DCTN3 antibody

STJ72399 100 µg
EUR 260

Anti-DCTN3 antibody

STJ72400 100 µg
EUR 359

Mouse DCTN3 shRNA Plasmid

20-abx974349
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DCTN3 shRNA Plasmid

20-abx957717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCTN3 Antibody, HRP conjugated

1-CSB-PA006566LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DCTN3 Antibody, FITC conjugated

1-CSB-PA006566LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DCTN3 Antibody, Biotin conjugated

1-CSB-PA006566LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN3. Recognizes DCTN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DCTN3 Recombinant Protein (Human)

RP008860 100 ug Ask for price

DCTN3 Recombinant Protein (Rat)

RP197492 100 ug Ask for price

DCTN3 Recombinant Protein (Mouse)

RP128180 100 ug Ask for price

DCTN3 Recombinant Protein (Mouse)

RP128183 100 ug Ask for price

Polyclonal DCTN3 Antibody (internal region)

APG00714G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DCTN3 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal DCTN3 Antibody (internal region)

APG00715G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DCTN3 (internal region). This antibody is tested and proven to work in the following applications:

Dynactin Subunit 3 (DCTN3) Antibody

abx149748-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody

20-abx321092
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody

20-abx321093
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody

abx431970-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dynactin Subunit 3 (DCTN3) Antibody

abx431971-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Dynactin Subunit 3 (DCTN3) Antibody

20-abx301171
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody

20-abx210222
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody

20-abx210223
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

DCTN3 Polyclonal Antibody, HRP Conjugated

A57038 100 µg
EUR 570.55
Description: kits suitable for this type of research

DCTN3 Polyclonal Antibody, FITC Conjugated

A57039 100 µg
EUR 570.55
Description: fast delivery possible

DCTN3 Polyclonal Antibody, Biotin Conjugated

A57040 100 µg
EUR 570.55
Description: reagents widely cited

Human Dynactin subunit 3 (DCTN3)

1-CSB-EP006566HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dynactin subunit 3(DCTN3) expressed in E.coli

DCTN3 ORF Vector (Human) (pORF)

ORF002954 1.0 ug DNA
EUR 95

Dctn3 ORF Vector (Rat) (pORF)

ORF065832 1.0 ug DNA
EUR 506

Dctn3 ORF Vector (Mouse) (pORF)

ORF042728 1.0 ug DNA
EUR 506

Dctn3 ORF Vector (Mouse) (pORF)

ORF042729 1.0 ug DNA
EUR 506

DCTN3 sgRNA CRISPR Lentivector set (Human)

K0567401 3 x 1.0 ug
EUR 339

Dynactin Subunit 3 (DCTN3) Antibody (HRP)

20-abx303590
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody (FITC)

20-abx303591
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dynactin Subunit 3 (DCTN3) Antibody (Biotin)

20-abx303592
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Dynactin 3 (DCTN3)ELISA Kit

201-12-2661 96 tests
EUR 440
  • This Dynactin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Dctn3 sgRNA CRISPR Lentivector set (Mouse)

K3108201 3 x 1.0 ug
EUR 339

Dctn3 sgRNA CRISPR Lentivector set (Rat)

K6032901 3 x 1.0 ug
EUR 339

Human Dynactin 3(DCTN3)ELISA Kit

QY-E03780 96T
EUR 361

Mouse Dynactin subunit 3, Dctn3 ELISA KIT

ELI-26362m 96 Tests
EUR 865

Bovine Dynactin subunit 3, DCTN3 ELISA KIT

ELI-26525b 96 Tests
EUR 928

Human Dynactin subunit 3, DCTN3 ELISA KIT

ELI-08944h 96 Tests
EUR 824

DCTN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0567402 1.0 ug DNA
EUR 154

DCTN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0567403 1.0 ug DNA
EUR 154

DCTN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0567404 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3108202 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3108203 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3108204 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6032902 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6032903 1.0 ug DNA
EUR 154

Dctn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6032904 1.0 ug DNA
EUR 154

DCTN3 Protein Vector (Human) (pPB-C-His)

PV011813 500 ng
EUR 329

DCTN3 Protein Vector (Human) (pPB-N-His)

PV011814 500 ng
EUR 329

DCTN3 Protein Vector (Human) (pPM-C-HA)

PV011815 500 ng
EUR 329

DCTN3 Protein Vector (Human) (pPM-C-His)

PV011816 500 ng
EUR 329

DCTN3 Protein Vector (Mouse) (pPB-C-His)

PV170910 500 ng
EUR 603