  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT8 antibody

70R-3562 50 ug
EUR 467
Description: Rabbit polyclonal CCT8 antibody

CCT8 Antibody

ABD4561 100 ug
EUR 438

CCT8 antibody

70R-16252 50 ul
EUR 435
Description: Rabbit polyclonal CCT8 antibody

CCT8 Antibody

DF4561 200ul
EUR 304
Description: CCT8 Antibody detects endogenous levels of total CCT8.

CCT8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CCT8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CCT8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CCT8 cloning plasmid

CSB-CL004873HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1647
  • Sequence: atggcgcttcacgttcccaaggctccgggctttgcccagatgctcaaggagggagcgaaacacttttcaggattagaagaggctgtgtatagaaacatacaagcttgcaaggagcttgcccaaaccactcgtacagcatatggaccaaatggaatgaacaaaatggttatcaacc
  • Show more
Description: A cloning plasmid for the CCT8 gene.

anti- CCT8 antibody

FNab01404 100µg
EUR 505.25
  • Immunogen: chaperonin containing TCP1, subunit 8(theta)
  • Uniprot ID: P50990
  • Gene ID: 10694
  • Research Area: Metabolism
Description: Antibody raised against CCT8

CCT8 Rabbit pAb

A4449-100ul 100 ul
EUR 308

CCT8 Rabbit pAb

A4449-200ul 200 ul
EUR 459

CCT8 Rabbit pAb

A4449-20ul 20 ul
EUR 183

CCT8 Rabbit pAb

A4449-50ul 50 ul
EUR 223

CCT8 Blocking Peptide

33R-2076 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCT8 antibody, catalog no. 70R-3562

CCT8 Polyclonal Antibody

30568-100ul 100ul
EUR 252

CCT8 Polyclonal Antibody

30568-50ul 50ul
EUR 187

CCT8 Blocking Peptide

DF4561-BP 1mg
EUR 195

Anti-CCT8 antibody

PAab01404 100 ug
EUR 355

Anti-CCT8 antibody

STJ111219 100 µl
EUR 277
Description: This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1.

CCT8 Polyclonal Conjugated Antibody

C30568 100ul
EUR 397


EF008485 96 Tests
EUR 689

Human CCT8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCT8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCT8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCT8 Recombinant Protein (Human)

RP006262 100 ug Ask for price

CCT8 Recombinant Protein (Rat)

RP193829 100 ug Ask for price

CCT8 Recombinant Protein (Mouse)

RP122324 100 ug Ask for price

CCT8 ORF Vector (Human) (pORF)

ORF002088 1.0 ug DNA
EUR 95

Anti-TCP1 theta/CCT8 Antibody

PB9993 100ug/vial
EUR 334

Cct8 ORF Vector (Mouse) (pORF)

ORF040776 1.0 ug DNA
EUR 506

Cct8 ORF Vector (Rat) (pORF)

ORF064611 1.0 ug DNA
EUR 506

[One Step] CCT8 Antibody Kit

RK05632 50 ul
EUR 240

CCT8 ELISA Kit (Human) (OKCA00834)

OKCA00834 96 Wells
EUR 833
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. Known to play a role, in vitro, in the folding of actin and tubulin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.95 pg/mL

CCT8 sgRNA CRISPR Lentivector set (Human)

K0398201 3 x 1.0 ug
EUR 339

Cct8 sgRNA CRISPR Lentivector set (Mouse)

K4940101 3 x 1.0 ug
EUR 339

Cct8 sgRNA CRISPR Lentivector set (Rat)

K6623901 3 x 1.0 ug
EUR 339

CCT8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0398202 1.0 ug DNA
EUR 154

CCT8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0398203 1.0 ug DNA
EUR 154

CCT8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0398204 1.0 ug DNA
EUR 154

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4940102 1.0 ug DNA
EUR 154

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4940103 1.0 ug DNA
EUR 154

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4940104 1.0 ug DNA
EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6623902 1.0 ug DNA
EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6623903 1.0 ug DNA
EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6623904 1.0 ug DNA
EUR 154

CCT8 Protein Vector (Human) (pPB-C-His)

PV008349 500 ng
EUR 329

CCT8 Protein Vector (Human) (pPB-N-His)

PV008350 500 ng
EUR 329

CCT8 Protein Vector (Human) (pPM-C-HA)

PV008351 500 ng
EUR 329

CCT8 Protein Vector (Human) (pPM-C-His)

PV008352 500 ng
EUR 329

CCT8 Protein Vector (Rat) (pPB-C-His)

PV258442 500 ng
EUR 603

CCT8 Protein Vector (Rat) (pPB-N-His)

PV258443 500 ng
EUR 603

CCT8 Protein Vector (Rat) (pPM-C-HA)

PV258444 500 ng
EUR 603

CCT8 Protein Vector (Rat) (pPM-C-His)

PV258445 500 ng
EUR 603

CCT8 Protein Vector (Mouse) (pPB-C-His)

PV163102 500 ng
EUR 603

CCT8 Protein Vector (Mouse) (pPB-N-His)

PV163103 500 ng
EUR 603

CCT8 Protein Vector (Mouse) (pPM-C-HA)

PV163104 500 ng
EUR 603

CCT8 Protein Vector (Mouse) (pPM-C-His)

PV163105 500 ng
EUR 603

Cct8 3'UTR Luciferase Stable Cell Line

TU201929 1.0 ml Ask for price

Cct8 3'UTR GFP Stable Cell Line

TU153443 1.0 ml Ask for price

CCT8 3'UTR Luciferase Stable Cell Line

TU003848 1.0 ml
EUR 1394

Cct8 3'UTR Luciferase Stable Cell Line

TU103443 1.0 ml Ask for price

CCT8 3'UTR GFP Stable Cell Line

TU053848 1.0 ml
EUR 1394

Cct8 3'UTR GFP Stable Cell Line

TU251929 1.0 ml Ask for price

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

abx146227-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

abx413784-01mg 0.1 mg
EUR 495
  • Shipped within 1 week.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody

abx231404-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CCT8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640417 1.0 ug DNA
EUR 682

CCT8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640421 1.0 ug DNA
EUR 682

CCT8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640422 1.0 ug DNA
EUR 682

Recombinant Candida Albicans CCT8 Protein (aa 1-540)

VAng-Lsx05384-inquire inquire Ask for price
Description: Candida Albicans T-complex protein 1 subunit theta, recombinant protein.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit

E03T0605-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit

E03T0605-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit

E03T0605-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit

E01T0605-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit

E01T0605-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit

E01T0605-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit

E02T0605-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit

E02T0605-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit

E02T0605-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.