CellXerum Serum Free Cell Culture Medium

CellXerum Serum Free Cell Culture Medium

ARSI

ARSI siRNA
20-abx900462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSI siRNA
20-abx908239
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSI siRNA
20-abx908240
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSI antibody
70R-34066 100 ug
EUR 327
Description: Rabbit polyclonal ARSI antibody

ARSI Antibody
ABD3798 100 ug
EUR 438

ARSI Antibody
34444-100ul 100ul
EUR 252

ARSI Antibody
34444-50ul 50ul
EUR 187

ARSI Antibody
DF3798 200ul
EUR 304
Description: ARSI Antibody detects endogenous levels of total ARSI.

ARSI Antibody
1-CSB-PA000936
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

ARSI Antibody
CSB-PA285764-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ARSI Antibody
CSB-PA285764-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ARSI Antibody
1-CSB-PA685925LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ARSI Conjugated Antibody
C34444 100ul
EUR 397

ARSI Polyclonal Antibody
A65054 100 µg
EUR 570.55
Description: kits suitable for this type of research

ARSI Blocking Peptide
DF3798-BP 1mg
EUR 195

ARSI cloning plasmid
CSB-CL685925HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: ATGCACACCCTCACTGGCTTCTCCCTGGTCAGCCTGCTCAGCTTCGGCTACCTGTCCTGGGACTGGGCCAAGCCGAGCTTCGTGGCCGACGGGCCCGGGGAGGCTGGCGAGCAGCCCTCGGCCGCTCCGCCCCAGCCTCCCCACATCATCTTCATCCTCACGGACGACCAAGGCT
  • Show more
Description: A cloning plasmid for the ARSI gene.

Rat ARSI shRNA Plasmid
20-abx989433
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ARSI shRNA Plasmid
20-abx984112
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine ARSI ELISA KIT
ELI-11759d 96 Tests
EUR 928

Arylsulfatase I (ARSI) Antibody
abx122809-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
20-abx133696
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
abx034571-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
abx034571-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
20-abx014213
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
20-abx301407
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ARSI shRNA Plasmid
20-abx967324
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARSI Antibody, HRP conjugated
1-CSB-PA685925LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARSI Antibody, FITC conjugated
1-CSB-PA685925LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARSI Antibody, Biotin conjugated
1-CSB-PA685925LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ARSI Recombinant Protein (Human)
RP036751 100 ug Ask for price

ARSI Recombinant Protein (Rat)
RP191066 100 ug Ask for price

ARSI Recombinant Protein (Mouse)
RP117359 100 ug Ask for price

Polyclonal ARSI Antibody (C-term)
APR15075G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARSI (C-term). This antibody is tested and proven to work in the following applications:

Anti-ARSI/Arylsulfatase I Antibody
A08580 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARSI (ARSI) detection.tested for IF, IHC, WB in Human.

ARSI Polyclonal Antibody, HRP Conjugated
A65055 100 µg
EUR 570.55
Description: fast delivery possible

ARSI Polyclonal Antibody, FITC Conjugated
A65056 100 µg
EUR 570.55
Description: reagents widely cited

ARSI Polyclonal Antibody, Biotin Conjugated
A65057 100 µg
EUR 570.55
Description: Ask the seller for details

Arsi ORF Vector (Mouse) (pORF)
ORF039121 1.0 ug DNA
EUR 506

ARSI ORF Vector (Human) (pORF)
ORF012251 1.0 ug DNA
EUR 354

Arsi ORF Vector (Rat) (pORF)
ORF063690 1.0 ug DNA
EUR 506

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase I(ARSI) ELISA kit
E03A1690-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase I(ARSI) ELISA kit
E03A1690-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase I(ARSI) ELISA kit
E03A1690-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase I(ARSI) ELISA kit
E04A1690-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.