ARSI

ARSI Antibody
34444-100ul	SAB	100ul	EUR 252

ARSI Antibody
34444-50ul	SAB	50ul	EUR 187

ARSI Antibody
1-CSB-PA000936	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

ARSI Antibody
1-CSB-PA685925LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ARSI Antibody
DF3798	Affbiotech	200ul	EUR 304
Description: ARSI Antibody detects endogenous levels of total ARSI.

ARSI Antibody
CSB-PA285764-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ARSI Antibody
CSB-PA285764-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ARSI antibody
70R-34066	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ARSI antibody

ARSI siRNA
20-abx900462	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARSI siRNA
20-abx908239	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARSI siRNA
20-abx908240	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARSI Antibody
ABD3798	Lifescience Market	100 ug	EUR 438

ARSI Blocking Peptide
DF3798-BP	Affbiotech	1mg	EUR 195

ARSI Conjugated Antibody
C34444	SAB	100ul	EUR 397

ARSI cloning plasmid
CSB-CL685925HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1710 Sequence: ATGCACACCCTCACTGGCTTCTCCCTGGTCAGCCTGCTCAGCTTCGGCTACCTGTCCTGGGACTGGGCCAAGCCGAGCTTCGTGGCCGACGGGCCCGGGGAGGCTGGCGAGCAGCCCTCGGCCGCTCCGCCCCAGCCTCCCCACATCATCTTCATCCTCACGGACGACCAAGGCT Show more
Description: A cloning plasmid for the ARSI gene.

ARSI Polyclonal Antibody
A65054	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ARSI Antibody, HRP conjugated
1-CSB-PA685925LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARSI Antibody, FITC conjugated
1-CSB-PA685925LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARSI Antibody, Biotin conjugated
1-CSB-PA685925LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSI. Recognizes ARSI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Arylsulfatase I (ARSI) Antibody
20-abx133696	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
abx122809-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
20-abx014213	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
abx034571-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Arylsulfatase I (ARSI) Antibody
abx034571-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Canine ARSI ELISA KIT
ELI-11759d	Lifescience Market	96 Tests	EUR 928

Rat ARSI shRNA Plasmid
20-abx989433	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ARSI shRNA Plasmid
20-abx967324	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ARSI shRNA Plasmid
20-abx984112	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Arylsulfatase I (ARSI) Antibody
20-abx301407	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ARSI Recombinant Protein (Human)
RP036751	ABM	100 ug	Ask for price

ARSI Recombinant Protein (Mouse)
RP117359	ABM	100 ug	Ask for price

ARSI Recombinant Protein (Rat)
RP191066	ABM	100 ug	Ask for price

Anti-ARSI/Arylsulfatase I Antibody
A08580	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for ARSI (ARSI) detection.tested for IF, IHC, WB in Human.

Polyclonal ARSI Antibody (C-term)
APR15075G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARSI (C-term). This antibody is tested and proven to work in the following applications:

ARSI Polyclonal Antibody, HRP Conjugated
A65055	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

ARSI Polyclonal Antibody, FITC Conjugated
A65056	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ARSI Polyclonal Antibody, Biotin Conjugated
A65057	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Arsi ORF Vector (Rat) (pORF)
ORF063690	ABM	1.0 ug DNA	EUR 506

ARSI ORF Vector (Human) (pORF)
ORF012251	ABM	1.0 ug DNA	EUR 354

Arsi ORF Vector (Mouse) (pORF)
ORF039121	ABM	1.0 ug DNA	EUR 506

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase I(ARSI) ELISA kit
E01A1690-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase I(ARSI) ELISA kit
E02A1690-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase I(ARSI) ELISA kit
E02A1690-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase I(ARSI) ELISA kit
E02A1690-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase I(ARSI) ELISA kit
E06A1690-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase I(ARSI) ELISA kit
E03A1690-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase I(ARSI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.