ARSG

ARSG antibody

70R-15853 50 ul
EUR 435
Description: Rabbit polyclonal ARSG antibody

ARSG Antibody

36153-100ul 100ul
EUR 252

ARSG Antibody

1-CSB-PA002150GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARSG Antibody

1-CSB-PA002150LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ARSG Antibody

1-CSB-PA909692
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ARSG Antibody

DF3797 200ul
EUR 304
Description: ARSG Antibody detects endogenous levels of total ARSG.

ARSG Antibody

1-CSB-PA438801
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Arsg antibody

70R-9308 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arsg antibody

ARSG antibody

70R-34065 100 ug
EUR 327
Description: Rabbit polyclonal ARSG antibody

ARSG Antibody

1-CSB-PA008275
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

ARSG siRNA

20-abx900460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA

20-abx908234
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA

20-abx908235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG Antibody

ABD3797 100 ug
EUR 438

ARSG Rabbit pAb

A13764-100ul 100 ul
EUR 308

ARSG Rabbit pAb

A13764-200ul 200 ul
EUR 459

ARSG Rabbit pAb

A13764-20ul 20 ul
EUR 183

ARSG Rabbit pAb

A13764-50ul 50 ul
EUR 223

Arsg Blocking Peptide

33R-3523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arsg antibody, catalog no. 70R-9308

ARSG Blocking Peptide

DF3797-BP 1mg
EUR 195

ARSG Enzyme (Recombinant)

20-abx073379
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ARSG Conjugated Antibody

C36153 100ul
EUR 397

ARSG cloning plasmid

CSB-CL002150HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: atgggctggctttttctaaaggttttgttggcgggagtgagtttctcaggatttctttatcctcttgtggatttttgcatcagtgggaaaacaagaggacagaagccaaactttgtgattattttggccgatgacatggggtggggtgacctgggagcaaactgggcagaaacaa
  • Show more
Description: A cloning plasmid for the ARSG gene.

ARSG Polyclonal Antibody

A50049 100 µg
EUR 570.55
Description: The best epigenetics products

ARSG Rabbit pAb

A17102-100ul 100 ul
EUR 308

ARSG Rabbit pAb

A17102-200ul 200 ul
EUR 459

ARSG Rabbit pAb

A17102-20ul 20 ul
EUR 183

ARSG Rabbit pAb

A17102-50ul 50 ul
EUR 223

anti- ARSG antibody

FNab00612 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: arylsulfatase G
  • Uniprot ID: Q96EG1
  • Gene ID: 22901
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ARSG

Anti-ARSG antibody

PAab00612 100 ug
EUR 386

Anti-ARSG antibody

STJ115711 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene.

Anti-ARSG antibody

STJ119348 100 µl
EUR 277

ARSG protein (His tag)

30R-2949 100 ug
EUR 322
Description: Purified recombinant Human ARSG protein (His tag)

ARSG Antibody, HRP conjugated

1-CSB-PA002150LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARSG Antibody, FITC conjugated

1-CSB-PA002150LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARSG Antibody, Biotin conjugated

1-CSB-PA002150LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Arylsulfatase G (ARSG)

1-CSB-EP002150HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Arylsulfatase G(ARSG) expressed in E.coli

Arylsulfatase G (ARSG) Antibody

20-abx214560
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx111082
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

abx036398-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx133695
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx242531
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ARSG ELISA KIT|Human

EF007921 96 Tests
EUR 689

Rat ARSG shRNA Plasmid

20-abx989225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ARSG shRNA Plasmid

20-abx978052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Arylsulfatase G (ARSG) Antibody

20-abx328812
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

abx230612-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Arylsulfatase G (ARSG) Antibody

20-abx303125
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ARSG shRNA Plasmid

20-abx957856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine ARSG ELISA KIT

ELI-34762d 96 Tests
EUR 928

ARSG Recombinant Protein (Human)

RP001978 100 ug Ask for price

ARSG Recombinant Protein (Mouse)

RP117353 100 ug Ask for price

ARSG Recombinant Protein (Mouse)

RP117356 100 ug Ask for price

ARSG Recombinant Protein (Rat)

RP191063 100 ug Ask for price

Human Arylsulfatase G (ARSG) Antibody

32248-05111 150 ug
EUR 261

Arylsulfatase G (ARSG) Antibody (HRP)

20-abx303126
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody (FITC)

20-abx303127
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody (Biotin)

20-abx303128
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ARSG Polyclonal Antibody, HRP Conjugated

A50050 100 µg
EUR 570.55
Description: kits suitable for this type of research

ARSG Polyclonal Antibody, FITC Conjugated

A50051 100 µg
EUR 570.55
Description: fast delivery possible

ARSG Polyclonal Antibody, Biotin Conjugated

A50052 100 µg
EUR 570.55
Description: reagents widely cited

Arsg ORF Vector (Rat) (pORF)

ORF063689 1.0 ug DNA
EUR 506

ARSG ORF Vector (Human) (pORF)

ORF000660 1.0 ug DNA
EUR 95

Arsg ORF Vector (Mouse) (pORF)

ORF039119 1.0 ug DNA
EUR 506

Arsg ORF Vector (Mouse) (pORF)

ORF039120 1.0 ug DNA
EUR 506

Human Arylsulfatase G(ARSG) ELISA kit

E01A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase G(ARSG) ELISA kit

E01A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase G(ARSG) ELISA kit

E01A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase G(ARSG) ELISA kit

E02A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase G(ARSG) ELISA kit

E02A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase G(ARSG) ELISA kit

E02A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase G(ARSG) ELISA kit

E06A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase G(ARSG) ELISA kit

E06A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase G(ARSG) ELISA kit

E06A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase G(ARSG) ELISA kit

E03A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase G(ARSG) ELISA kit

E03A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase G(ARSG) ELISA kit

E03A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase G(ARSG) ELISA kit

E04A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase G(ARSG) ELISA kit

E04A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase G(ARSG) ELISA kit

E04A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase G(ARSG) ELISA kit

E07A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase G(ARSG) ELISA kit

E07A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase G(ARSG) ELISA kit

E07A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase G(ARSG) ELISA kit

E08A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase G(ARSG) ELISA kit

E08A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase G(ARSG) ELISA kit

E08A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase G(ARSG) ELISA kit

E09A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase G(ARSG) ELISA kit

E09A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase G(ARSG) ELISA kit

E09A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase G, ARSG ELISA KIT

ELI-11861h 96 Tests
EUR 824

Human Arylsulfatase G (ARSG) ELISA Kit

20-abx385878
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Arylsulfatase G, Arsg ELISA KIT

ELI-34323m 96 Tests
EUR 865

Arsg sgRNA CRISPR Lentivector set (Rat)

K6270201 3 x 1.0 ug
EUR 339

Arsg sgRNA CRISPR Lentivector set (Mouse)

K4543801 3 x 1.0 ug
EUR 339

ARSG sgRNA CRISPR Lentivector set (Human)

K0128501 3 x 1.0 ug
EUR 339

ARSG Arylsulfatase G Human Recombinant Protein

PROTQ96EG1 Regular: 20ug
EUR 317
Description: ARSG Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 532 amino acids (17-525) and having a molecular mass of 57kDa.;ARSG is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Arylsulfatase G(ARSG)ELISA Kit

QY-E03644 96T
EUR 361

Human Arylsulfatase G (ARSG) Antibody (Biotin Conjugate)

32248-05121 150 ug
EUR 369

Guinea pig Arylsulfatase G(ARSG) ELISA kit

E05A1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Arylsulfatase G(ARSG) ELISA kit

E05A1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Arylsulfatase G(ARSG) ELISA kit

E05A1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase G(ARSG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Arsg sgRNA CRISPR Lentivector (Rat) (Target 1)

K6270202 1.0 ug DNA
EUR 154

Arsg sgRNA CRISPR Lentivector (Rat) (Target 2)

K6270203 1.0 ug DNA
EUR 154

Arsg sgRNA CRISPR Lentivector (Rat) (Target 3)

K6270204 1.0 ug DNA
EUR 154

Arsg sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4543802 1.0 ug DNA
EUR 154

Arsg sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4543803 1.0 ug DNA
EUR 154

Arsg sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4543804 1.0 ug DNA
EUR 154

ARSG sgRNA CRISPR Lentivector (Human) (Target 1)

K0128502 1.0 ug DNA
EUR 154

ARSG sgRNA CRISPR Lentivector (Human) (Target 2)

K0128503 1.0 ug DNA
EUR 154

ARSG sgRNA CRISPR Lentivector (Human) (Target 3)

K0128504 1.0 ug DNA
EUR 154

ARSG Protein Vector (Mouse) (pPB-C-His)

PV156474 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPB-N-His)

PV156475 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPM-C-HA)

PV156476 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPM-C-His)

PV156477 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPB-C-His)

PV156478 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPB-N-His)

PV156479 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPM-C-HA)

PV156480 500 ng
EUR 603

ARSG Protein Vector (Mouse) (pPM-C-His)

PV156481 500 ng
EUR 603

ARSG Protein Vector (Rat) (pPB-C-His)

PV254754 500 ng
EUR 603

ARSG Protein Vector (Rat) (pPB-N-His)

PV254755 500 ng
EUR 603

ARSG Protein Vector (Rat) (pPM-C-HA)

PV254756 500 ng
EUR 603

ARSG Protein Vector (Rat) (pPM-C-His)

PV254757 500 ng
EUR 603

ARSG Protein Vector (Human) (pPB-His-MBP)

PV324046 500 ng
EUR 329

ARSG Protein Vector (Human) (pPB-His-GST)

PV324047 500 ng
EUR 329

ARSG Protein Vector (Human) (pPB-C-His)

PV002637 500 ng
EUR 329

ARSG Protein Vector (Human) (pPB-N-His)

PV002638 500 ng
EUR 329

ARSG Protein Vector (Human) (pPM-C-HA)

PV002639 500 ng
EUR 329

ARSG Protein Vector (Human) (pPM-C-His)

PV002640 500 ng
EUR 329

Arsg 3'UTR GFP Stable Cell Line

TU152165 1.0 ml Ask for price

Arsg 3'UTR Luciferase Stable Cell Line

TU102165 1.0 ml Ask for price

Arsg 3'UTR Luciferase Stable Cell Line

TU200936 1.0 ml Ask for price

Arsg 3'UTR GFP Stable Cell Line

TU250936 1.0 ml Ask for price

ARSG 3'UTR GFP Stable Cell Line

TU051200 1.0 ml
EUR 2333

ARSG 3'UTR Luciferase Stable Cell Line

TU001200 1.0 ml
EUR 2333

Human Arylsulfatase G (ARSG) AssayLite Antibody (FITC Conjugate)

32248-05141 150 ug
EUR 428

Human Arylsulfatase G (ARSG) AssayLite Antibody (RPE Conjugate)

32248-05151 150 ug
EUR 428

Human Arylsulfatase G (ARSG) AssayLite Antibody (APC Conjugate)

32248-05161 150 ug
EUR 428

Human Arylsulfatase G (ARSG) AssayLite Antibody (PerCP Conjugate)

32248-05171 150 ug
EUR 471

ARSG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV683515 1.0 ug DNA
EUR 682

ARSG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV683519 1.0 ug DNA
EUR 682

ARSG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV683520 1.0 ug DNA
EUR 682

ARSG Protein Vector (Human) (pPM-N-D-C-HA)

PV324048 500 ng
EUR 552

ARSG Protein Vector (Human) (pPM-N-D-C-His)

PV324049 500 ng
EUR 552

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6270205 3 x 1.0 ug
EUR 376

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4543805 3 x 1.0 ug
EUR 376

ARSG sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0128505 3 x 1.0 ug
EUR 376

ARSG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV683516 1.0 ug DNA
EUR 682

ARSG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV683517 1.0 ug DNA
EUR 740

ARSG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV683518 1.0 ug DNA
EUR 740

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6270206 1.0 ug DNA
EUR 167

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6270207 1.0 ug DNA
EUR 167

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6270208 1.0 ug DNA
EUR 167

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4543806 1.0 ug DNA
EUR 167

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4543807 1.0 ug DNA
EUR 167

Arsg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4543808 1.0 ug DNA
EUR 167

ARSG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0128506 1.0 ug DNA
EUR 167

ARSG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0128507 1.0 ug DNA
EUR 167

ARSG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0128508 1.0 ug DNA
EUR 167