ARSG

ARSG antibody

70R-15853 50 ul
EUR 435
Description: Rabbit polyclonal ARSG antibody

ARSG Antibody

36153-100ul 100ul
EUR 252

ARSG Antibody

1-CSB-PA002150GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARSG Antibody

1-CSB-PA002150LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ARSG Antibody

1-CSB-PA909692
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ARSG Antibody

DF3797 200ul
EUR 304
Description: ARSG Antibody detects endogenous levels of total ARSG.

ARSG Antibody

1-CSB-PA438801
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Arsg antibody

70R-9308 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arsg antibody

ARSG antibody

70R-34065 100 ug
EUR 327
Description: Rabbit polyclonal ARSG antibody

ARSG Antibody

1-CSB-PA008275
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

ARSG siRNA

20-abx900460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA

20-abx908234
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA

20-abx908235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG Antibody

ABD3797 100 ug
EUR 438

ARSG Rabbit pAb

A13764-100ul 100 ul
EUR 308

ARSG Rabbit pAb

A13764-200ul 200 ul
EUR 459

ARSG Rabbit pAb

A13764-20ul 20 ul
EUR 183

ARSG Rabbit pAb

A13764-50ul 50 ul
EUR 223

Arsg Blocking Peptide

33R-3523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arsg antibody, catalog no. 70R-9308

ARSG Blocking Peptide

DF3797-BP 1mg
EUR 195

ARSG Enzyme (Recombinant)

20-abx073379
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ARSG Conjugated Antibody

C36153 100ul
EUR 397

ARSG cloning plasmid

CSB-CL002150HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: atgggctggctttttctaaaggttttgttggcgggagtgagtttctcaggatttctttatcctcttgtggatttttgcatcagtgggaaaacaagaggacagaagccaaactttgtgattattttggccgatgacatggggtggggtgacctgggagcaaactgggcagaaacaa
  • Show more
Description: A cloning plasmid for the ARSG gene.

ARSG Polyclonal Antibody

A50049 100 µg
EUR 570.55
Description: The best epigenetics products

ARSG Rabbit pAb

A17102-100ul 100 ul
EUR 308

ARSG Rabbit pAb

A17102-200ul 200 ul
EUR 459

ARSG Rabbit pAb

A17102-20ul 20 ul
EUR 183

ARSG Rabbit pAb

A17102-50ul 50 ul
EUR 223

anti- ARSG antibody

FNab00612 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: arylsulfatase G
  • Uniprot ID: Q96EG1
  • Gene ID: 22901
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ARSG

Anti-ARSG antibody

PAab00612 100 ug
EUR 386

Anti-ARSG antibody

STJ115711 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene.

Anti-ARSG antibody

STJ119348 100 µl
EUR 277

ARSG protein (His tag)

30R-2949 100 ug
EUR 322
Description: Purified recombinant Human ARSG protein (His tag)

ARSG Antibody, HRP conjugated

1-CSB-PA002150LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARSG Antibody, FITC conjugated

1-CSB-PA002150LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARSG Antibody, Biotin conjugated

1-CSB-PA002150LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Arylsulfatase G (ARSG)

1-CSB-EP002150HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Arylsulfatase G(ARSG) expressed in E.coli

Arylsulfatase G (ARSG) Antibody

20-abx214560
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx111082
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

abx036398-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx133695
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

20-abx242531
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ARSG ELISA KIT|Human

EF007921 96 Tests
EUR 689

Rat ARSG shRNA Plasmid

20-abx989225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ARSG shRNA Plasmid

20-abx978052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Arylsulfatase G (ARSG) Antibody

20-abx328812
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody

abx230612-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Arylsulfatase G (ARSG) Antibody

20-abx303125
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ARSG shRNA Plasmid

20-abx957856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine ARSG ELISA KIT

ELI-34762d 96 Tests
EUR 928